Incidental Mutation 'R9665:Dscc1'
ID 727795
Institutional Source Beutler Lab
Gene Symbol Dscc1
Ensembl Gene ENSMUSG00000022422
Gene Name DNA replication and sister chromatid cohesion 1
Synonyms 2600005O03Rik, 2010006I05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock # R9665 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 55076099-55090491 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55083441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 296 (I296K)
Ref Sequence ENSEMBL: ENSMUSP00000105860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023059] [ENSMUST00000110231]
AlphaFold Q14AI0
Predicted Effect probably benign
Transcript: ENSMUST00000023059
SMART Domains Protein: ENSMUSP00000023059
Gene: ENSMUSG00000022422

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 48 364 7.3e-110 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110231
AA Change: I296K
SMART Domains Protein: ENSMUSP00000105860
Gene: ENSMUSG00000022422
AA Change: I296K

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 49 271 5.9e-62 PFAM
Pfam:DUF2036 284 426 4.3e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHTF18 (MIM 613201), CHTF8 (MIM 613202), and DSCC1 are components of an alternative replication factor C (RFC) (see MIM 600404) complex that loads PCNA (MIM 176740) onto DNA during S phase of the cell cycle (Merkle et al., 2003 [PubMed 12766176]; Bermudez et al., 2003 [PubMed 12930902]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,170,339 E79G probably damaging Het
4930583I09Rik T A 17: 64,834,293 Q78L unknown Het
9330159F19Rik G T 10: 29,227,348 V642F probably benign Het
Abca9 T A 11: 110,115,454 Q1275L probably benign Het
Abca9 G T 11: 110,115,455 Q1275K probably benign Het
Ager C T 17: 34,600,116 P313S probably benign Het
Ap4m1 T A 5: 138,173,011 N98K probably benign Het
Arhgef12 T G 9: 43,018,354 K215T possibly damaging Het
Arhgef4 T C 1: 34,810,437 Y370H probably benign Het
Bcat1 T G 6: 145,048,762 H3P probably benign Het
Btnl6 T A 17: 34,513,661 Q313L probably benign Het
Cad T C 5: 31,072,359 S1458P probably benign Het
Cfap161 A G 7: 83,793,371 V78A probably benign Het
Chd2 C A 7: 73,429,807 A1782S probably benign Het
Col4a3 A T 1: 82,690,580 T1042S unknown Het
Cramp1l A T 17: 24,977,571 N856K probably damaging Het
Crispld2 G A 8: 120,033,577 R414H probably benign Het
Ctsb T A 14: 63,133,468 probably null Het
Cyp2c69 T C 19: 39,851,060 D373G possibly damaging Het
Dnah3 A G 7: 120,045,758 V1100A probably benign Het
Dnajb6 A T 5: 29,766,376 L225F probably damaging Het
Epb41l2 A G 10: 25,441,900 D105G probably benign Het
Evpl G A 11: 116,232,671 R292C probably damaging Het
Fam166b T A 4: 43,427,554 R257* probably null Het
Flnc T C 6: 29,455,448 I2032T probably damaging Het
Fryl T A 5: 73,064,956 D2094V probably damaging Het
Gigyf2 A G 1: 87,403,735 S202G unknown Het
Gm8871 A G 5: 11,042,885 K132R Het
Hdgfl1 A T 13: 26,769,829 M87K probably benign Het
Htra3 T A 5: 35,679,310 I13F unknown Het
Igf2r T C 17: 12,694,140 N1774D probably benign Het
Ighj1 A T 12: 113,429,826 Y3N Het
Incenp T C 19: 9,893,965 H100R unknown Het
Klrb1c A G 6: 128,783,662 probably null Het
Lmbrd1 T A 1: 24,692,984 V94D probably damaging Het
Lmna A T 3: 88,482,486 S611T probably benign Het
Lsp1 A C 7: 142,490,405 I296L probably benign Het
Mdga1 A T 17: 29,833,017 I892N probably damaging Het
Micu3 A G 8: 40,375,625 E351G probably benign Het
Mrpl35 A G 6: 71,818,720 V61A probably benign Het
Nhsl1 A G 10: 18,525,851 K908E possibly damaging Het
Nlk A G 11: 78,590,927 L236P Het
Nwd1 T A 8: 72,674,478 H735Q probably damaging Het
Olfr1141 A T 2: 87,753,327 I222N probably damaging Het
Olfr22-ps1 A T 11: 73,954,830 I47F probably benign Het
Olfr74 A G 2: 87,974,252 S138P possibly damaging Het
Olfr871 T A 9: 20,213,106 Y252* probably null Het
Otof T A 5: 30,427,551 S70C probably benign Het
Park2 T A 17: 11,067,175 D18E possibly damaging Het
Pcdh20 A T 14: 88,469,726 V46D probably benign Het
Pjvk A G 2: 76,657,483 T240A probably benign Het
Pou2f1 A G 1: 165,876,031 S697P probably damaging Het
Prmt9 G A 8: 77,580,638 V739I probably benign Het
Prr14 A G 7: 127,473,919 D146G probably benign Het
Rai14 T G 15: 10,574,717 E747D probably damaging Het
Rapgef4 A T 2: 72,205,674 T504S probably benign Het
Rilpl2 C A 5: 124,478,177 probably benign Het
Ror2 A T 13: 53,285,525 M1K probably null Het
Shisa9 A G 16: 12,267,582 T352A probably benign Het
Slc35a4 A G 18: 36,680,598 N33S probably benign Het
Slx4 G T 16: 3,989,026 L518I probably benign Het
Spon2 T C 5: 33,217,358 T35A probably benign Het
Syne3 A C 12: 104,957,988 L471R probably benign Het
Tas2r115 A G 6: 132,737,427 L187S probably benign Het
Tbc1d30 G T 10: 121,266,981 S715R possibly damaging Het
Tdrd1 A G 19: 56,831,140 E24G probably benign Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tjp1 A G 7: 65,312,896 S1178P probably benign Het
Upf2 A G 2: 6,046,904 S1126G unknown Het
Vmn1r128 G T 7: 21,349,437 C22F probably damaging Het
Vmn2r95 G T 17: 18,440,345 V340F probably damaging Het
Vps13c A T 9: 67,955,743 K3014* probably null Het
Wdr75 T C 1: 45,803,853 V126A unknown Het
Yeats4 A T 10: 117,217,438 Y139* probably null Het
Zc3h13 A G 14: 75,330,549 D1094G probably damaging Het
Zfp143 C G 7: 110,093,207 I608M probably damaging Het
Zfp772 A T 7: 7,209,794 M1K probably null Het
Zfp827 A G 8: 79,180,127 M923V possibly damaging Het
Other mutations in Dscc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Dscc1 APN 15 55082325 splice site probably benign
IGL01879:Dscc1 APN 15 55086816 missense probably benign 0.21
BB001:Dscc1 UTSW 15 55082176 missense probably benign 0.03
BB011:Dscc1 UTSW 15 55082176 missense probably benign 0.03
PIT4498001:Dscc1 UTSW 15 55082315 missense probably benign 0.00
PIT4812001:Dscc1 UTSW 15 55082261 missense probably damaging 1.00
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0594:Dscc1 UTSW 15 55089052 missense possibly damaging 0.69
R0616:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R1458:Dscc1 UTSW 15 55086764 missense probably damaging 1.00
R1498:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55084139 missense probably damaging 0.98
R1985:Dscc1 UTSW 15 55080176 splice site probably benign
R2418:Dscc1 UTSW 15 55083424 nonsense probably null
R2419:Dscc1 UTSW 15 55083424 nonsense probably null
R3955:Dscc1 UTSW 15 55083553 missense probably benign 0.05
R4773:Dscc1 UTSW 15 55080258 missense probably benign 0.01
R5611:Dscc1 UTSW 15 55082173 missense probably benign 0.23
R6484:Dscc1 UTSW 15 55080290 nonsense probably null
R7562:Dscc1 UTSW 15 55084185 missense probably benign 0.15
R7662:Dscc1 UTSW 15 55076165 missense possibly damaging 0.95
R7924:Dscc1 UTSW 15 55082176 missense probably benign 0.03
R9263:Dscc1 UTSW 15 55084109 missense probably damaging 1.00
R9764:Dscc1 UTSW 15 55090278 missense probably benign 0.03
Z1088:Dscc1 UTSW 15 55080317 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TATTCTGGGAACTGCTACATGCC -3'
(R):5'- CTGAGGACATAGCATTTACATTCTG -3'

Sequencing Primer
(F):5'- GGAACTGCTACATGCCAAGGC -3'
(R):5'- ATGTATGCGTGTGCACAG -3'
Posted On 2022-10-06