Mutagenetix > Incidental Mutation

Incidental Mutation 'R9668:Tcaf3'

727919

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R9668 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 42589702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 818 (W818R)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]

AlphaFold

Q6QR59

Predicted Effect

probably damaging
Transcript: ENSMUST00000069023
AA Change: W818R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: W818R

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134707

SMART Domains

Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

Domain	Start	End	E-Value	Type
low complexity region	210	221	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox1	G	T	11: 116,198,311	Y60*	probably null	Het
Acp7	T	A	7: 28,615,137		probably null	Het
Adamts17	G	A	7: 67,147,690	V1052I	possibly damaging	Het
Ankrd13b	T	A	11: 77,477,768	E42V	possibly damaging	Het
Ano1	C	A	7: 144,610,842		probably null	Het
Atp5f1	C	T	3: 105,956,040	V27I	probably benign	Het
C2cd2	A	G	16: 97,870,218	S494P	probably damaging	Het
Cd320	G	A	17: 33,846,139	C82Y	probably damaging	Het
Cdc16	T	A	8: 13,767,552	S288T	possibly damaging	Het
Chrne	A	G	11: 70,616,953		probably null	Het
Col12a1	G	A	9: 79,639,678	Q2291*	probably null	Het
Cps1	A	G	1: 67,174,490	S794G	probably benign	Het
Csmd1	A	T	8: 16,211,758	D908E	probably benign	Het
Dpf1	C	T	7: 29,309,659	Q70*	probably null	Het
Fam227a	A	T	15: 79,642,243	N129K	probably benign	Het
Fcho2	T	A	13: 98,777,457	I211F	probably benign	Het
Fezf1	T	C	6: 23,247,575	D167G	probably benign	Het
Flt3	G	A	5: 147,356,884	P461S	probably benign	Het
Fry	G	T	5: 150,358,853	A314S	probably damaging	Het
Gm6309	A	G	5: 146,168,216	S296P	probably benign	Het
Gmppb	T	G	9: 108,051,163	V291G	probably damaging	Het
Hmcn1	G	T	1: 150,743,741	S1207R	probably benign	Het
Iars	C	T	13: 49,687,409	P6L	probably damaging	Het
Kdm5d	T	A	Y: 943,075	S1519R	possibly damaging	Het
Kpna2	G	A	11: 106,990,715	T363I	probably damaging	Het
Lrp1b	A	T	2: 41,185,970	H1886Q		Het
Mettl5	C	T	2: 69,881,379	D48N	probably benign	Het
Mfsd4a	C	T	1: 132,041,890	G442S	probably damaging	Het
Mief2	A	G	11: 60,731,248	T215A	probably damaging	Het
Myt1	C	T	2: 181,810,342	T824I	probably damaging	Het
Naprt	C	A	15: 75,893,432	V148L	possibly damaging	Het
Nckap1l	C	T	15: 103,473,850	R491C	probably damaging	Het
Nr1i2	A	G	16: 38,251,211	M321T	possibly damaging	Het
Nup107	A	T	10: 117,774,478	I355N	possibly damaging	Het
Olfr1253	T	G	2: 89,752,292	I179L	probably benign	Het
Olfr1277	T	G	2: 111,269,942	I142L	probably benign	Het
Olfr248	A	T	1: 174,391,332	N88Y	probably benign	Het
Olfr364-ps1	T	G	2: 37,146,506	M98R	probably damaging	Het
Olfr388-ps1	A	G	11: 73,724,832	I64T	probably benign	Het
Olfr418	G	A	1: 173,270,616	G147D	possibly damaging	Het
Pccb	T	C	9: 100,994,581	D320G	possibly damaging	Het
Pcdhgb6	A	T	18: 37,742,508	I90L	probably benign	Het
Pik3r2	A	G	8: 70,768,815	S682P	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plagl1	A	G	10: 13,128,722	Q578R	unknown	Het
Ppp1r42	A	G	1: 10,003,338	I9T	probably benign	Het
Ptcd3	A	T	6: 71,894,291	I315K	possibly damaging	Het
Rnf217	A	G	10: 31,608,406	L260P	probably damaging	Het
Selp	A	T	1: 164,141,406	H525L	possibly damaging	Het
Sh3rf2	T	A	18: 42,111,282	M303K	probably benign	Het
Shprh	A	T	10: 11,206,332	I1549F	probably damaging	Het
Slc38a7	G	T	8: 95,844,144	A244D	probably benign	Het
Stxbp6	G	T	12: 44,902,957	T63K	probably damaging	Het
Syne3	A	G	12: 104,932,209	S962P	probably damaging	Het
Syt10	T	C	15: 89,826,932	I133V	probably damaging	Het
Tars	T	A	15: 11,394,360	K64*	probably null	Het
Tekt2	C	T	4: 126,323,651	R207H	probably damaging	Het
Tldc1	T	C	8: 119,761,775	E436G	probably damaging	Het
Tmem70	A	C	1: 16,665,435	E43A	probably benign	Het
Trim72	C	A	7: 128,009,920	A298E	probably damaging	Het
Washc5	C	T	15: 59,346,213		probably null	Het
Zfp707	C	A	15: 75,975,236	F378L	possibly damaging	Het
Zfp839	G	A	12: 110,855,846	A365T	probably damaging	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92
R9419:Tcaf3	UTSW	6	42596782	missense	probably benign	0.00
R9440:Tcaf3	UTSW	6	42596972	nonsense	probably null
R9469:Tcaf3	UTSW	6	42596894	missense	probably benign	0.00
R9787:Tcaf3	UTSW	6	42597090	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATAGAGTGTCTGGGCACAGC -3'
(R):5'- AACCATCAGAAGTCTGGATGGAC -3'

Sequencing Primer
(F):5'- GGCACAGCTATGTAATTCTGC -3'
(R):5'- GGACTTTTCCACCTCACACCAC -3'

Posted On

2022-10-06