Incidental Mutation 'R9668:Shprh'
ID 727935
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9668 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 11149427-11217595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11206332 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1549 (I1549F)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541]
AlphaFold Q7TPQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: I1549F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: I1549F

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054814
AA Change: I1549F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: I1549F

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: I1549F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: I1549F

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,198,311 Y60* probably null Het
Acp7 T A 7: 28,615,137 probably null Het
Adamts17 G A 7: 67,147,690 V1052I possibly damaging Het
Ankrd13b T A 11: 77,477,768 E42V possibly damaging Het
Ano1 C A 7: 144,610,842 probably null Het
Atp5f1 C T 3: 105,956,040 V27I probably benign Het
C2cd2 A G 16: 97,870,218 S494P probably damaging Het
Cd320 G A 17: 33,846,139 C82Y probably damaging Het
Cdc16 T A 8: 13,767,552 S288T possibly damaging Het
Chrne A G 11: 70,616,953 probably null Het
Col12a1 G A 9: 79,639,678 Q2291* probably null Het
Cps1 A G 1: 67,174,490 S794G probably benign Het
Csmd1 A T 8: 16,211,758 D908E probably benign Het
Dpf1 C T 7: 29,309,659 Q70* probably null Het
Fam227a A T 15: 79,642,243 N129K probably benign Het
Fcho2 T A 13: 98,777,457 I211F probably benign Het
Fezf1 T C 6: 23,247,575 D167G probably benign Het
Flt3 G A 5: 147,356,884 P461S probably benign Het
Fry G T 5: 150,358,853 A314S probably damaging Het
Gm6309 A G 5: 146,168,216 S296P probably benign Het
Gmppb T G 9: 108,051,163 V291G probably damaging Het
Hmcn1 G T 1: 150,743,741 S1207R probably benign Het
Iars C T 13: 49,687,409 P6L probably damaging Het
Kdm5d T A Y: 943,075 S1519R possibly damaging Het
Kpna2 G A 11: 106,990,715 T363I probably damaging Het
Lrp1b A T 2: 41,185,970 H1886Q Het
Mettl5 C T 2: 69,881,379 D48N probably benign Het
Mfsd4a C T 1: 132,041,890 G442S probably damaging Het
Mief2 A G 11: 60,731,248 T215A probably damaging Het
Myt1 C T 2: 181,810,342 T824I probably damaging Het
Naprt C A 15: 75,893,432 V148L possibly damaging Het
Nckap1l C T 15: 103,473,850 R491C probably damaging Het
Nr1i2 A G 16: 38,251,211 M321T possibly damaging Het
Nup107 A T 10: 117,774,478 I355N possibly damaging Het
Olfr1253 T G 2: 89,752,292 I179L probably benign Het
Olfr1277 T G 2: 111,269,942 I142L probably benign Het
Olfr248 A T 1: 174,391,332 N88Y probably benign Het
Olfr364-ps1 T G 2: 37,146,506 M98R probably damaging Het
Olfr388-ps1 A G 11: 73,724,832 I64T probably benign Het
Olfr418 G A 1: 173,270,616 G147D possibly damaging Het
Pccb T C 9: 100,994,581 D320G possibly damaging Het
Pcdhgb6 A T 18: 37,742,508 I90L probably benign Het
Pik3r2 A G 8: 70,768,815 S682P probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plagl1 A G 10: 13,128,722 Q578R unknown Het
Ppp1r42 A G 1: 10,003,338 I9T probably benign Het
Ptcd3 A T 6: 71,894,291 I315K possibly damaging Het
Rnf217 A G 10: 31,608,406 L260P probably damaging Het
Selp A T 1: 164,141,406 H525L possibly damaging Het
Sh3rf2 T A 18: 42,111,282 M303K probably benign Het
Slc38a7 G T 8: 95,844,144 A244D probably benign Het
Stxbp6 G T 12: 44,902,957 T63K probably damaging Het
Syne3 A G 12: 104,932,209 S962P probably damaging Het
Syt10 T C 15: 89,826,932 I133V probably damaging Het
Tars T A 15: 11,394,360 K64* probably null Het
Tcaf3 A T 6: 42,589,702 W818R probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tldc1 T C 8: 119,761,775 E436G probably damaging Het
Tmem70 A C 1: 16,665,435 E43A probably benign Het
Trim72 C A 7: 128,009,920 A298E probably damaging Het
Washc5 C T 15: 59,346,213 probably null Het
Zfp707 C A 15: 75,975,236 F378L possibly damaging Het
Zfp839 G A 12: 110,855,846 A365T probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
R8995:Shprh UTSW 10 11164830 nonsense probably null
R9053:Shprh UTSW 10 11154702 missense probably benign 0.04
R9131:Shprh UTSW 10 11162845 missense possibly damaging 0.58
R9176:Shprh UTSW 10 11160576 missense probably benign 0.02
R9391:Shprh UTSW 10 11162889 missense probably benign 0.05
R9423:Shprh UTSW 10 11205263 missense probably damaging 1.00
R9563:Shprh UTSW 10 11166491 nonsense probably null
R9709:Shprh UTSW 10 11162830 missense possibly damaging 0.91
R9718:Shprh UTSW 10 11213504 missense probably damaging 1.00
R9750:Shprh UTSW 10 11164460 missense probably damaging 0.98
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGAGCTAGTGTTGTTGATTCTCC -3'
(R):5'- GGTACAAGGACCCCTTCAAAAG -3'

Sequencing Primer
(F):5'- GGTTTTGCTCATTTAACTGAAGTAC -3'
(R):5'- CCTTCTTATAGGGTTCAGGAC -3'
Posted On 2022-10-06