Incidental Mutation 'R9668:Tars'
ID 727950
Institutional Source Beutler Lab
Gene Symbol Tars
Ensembl Gene ENSMUSG00000022241
Gene Name threonyl-tRNA synthetase
Synonyms D15Wsu59e, ThrRS
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R9668 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 11382301-11399665 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 11394360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 64 (K64*)
Ref Sequence ENSEMBL: ENSMUSP00000022849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022849] [ENSMUST00000228814]
AlphaFold Q9D0R2
Predicted Effect probably null
Transcript: ENSMUST00000022849
AA Change: K64*
SMART Domains Protein: ENSMUSP00000022849
Gene: ENSMUSG00000022241
AA Change: K64*

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Pfam:TGS 82 142 7.5e-18 PFAM
tRNA_SAD 248 297 1.91e-16 SMART
Pfam:tRNA-synt_2b 396 607 5e-38 PFAM
Pfam:HGTP_anticodon 619 710 6.5e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228814
AA Change: K64*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,198,311 Y60* probably null Het
Acp7 T A 7: 28,615,137 probably null Het
Adamts17 G A 7: 67,147,690 V1052I possibly damaging Het
Ankrd13b T A 11: 77,477,768 E42V possibly damaging Het
Ano1 C A 7: 144,610,842 probably null Het
Atp5f1 C T 3: 105,956,040 V27I probably benign Het
C2cd2 A G 16: 97,870,218 S494P probably damaging Het
Cd320 G A 17: 33,846,139 C82Y probably damaging Het
Cdc16 T A 8: 13,767,552 S288T possibly damaging Het
Chrne A G 11: 70,616,953 probably null Het
Col12a1 G A 9: 79,639,678 Q2291* probably null Het
Cps1 A G 1: 67,174,490 S794G probably benign Het
Csmd1 A T 8: 16,211,758 D908E probably benign Het
Dpf1 C T 7: 29,309,659 Q70* probably null Het
Fam227a A T 15: 79,642,243 N129K probably benign Het
Fcho2 T A 13: 98,777,457 I211F probably benign Het
Fezf1 T C 6: 23,247,575 D167G probably benign Het
Flt3 G A 5: 147,356,884 P461S probably benign Het
Fry G T 5: 150,358,853 A314S probably damaging Het
Gm6309 A G 5: 146,168,216 S296P probably benign Het
Gmppb T G 9: 108,051,163 V291G probably damaging Het
Hmcn1 G T 1: 150,743,741 S1207R probably benign Het
Iars C T 13: 49,687,409 P6L probably damaging Het
Kdm5d T A Y: 943,075 S1519R possibly damaging Het
Kpna2 G A 11: 106,990,715 T363I probably damaging Het
Lrp1b A T 2: 41,185,970 H1886Q Het
Mettl5 C T 2: 69,881,379 D48N probably benign Het
Mfsd4a C T 1: 132,041,890 G442S probably damaging Het
Mief2 A G 11: 60,731,248 T215A probably damaging Het
Myt1 C T 2: 181,810,342 T824I probably damaging Het
Naprt C A 15: 75,893,432 V148L possibly damaging Het
Nckap1l C T 15: 103,473,850 R491C probably damaging Het
Nr1i2 A G 16: 38,251,211 M321T possibly damaging Het
Nup107 A T 10: 117,774,478 I355N possibly damaging Het
Olfr1253 T G 2: 89,752,292 I179L probably benign Het
Olfr1277 T G 2: 111,269,942 I142L probably benign Het
Olfr248 A T 1: 174,391,332 N88Y probably benign Het
Olfr364-ps1 T G 2: 37,146,506 M98R probably damaging Het
Olfr388-ps1 A G 11: 73,724,832 I64T probably benign Het
Olfr418 G A 1: 173,270,616 G147D possibly damaging Het
Pccb T C 9: 100,994,581 D320G possibly damaging Het
Pcdhgb6 A T 18: 37,742,508 I90L probably benign Het
Pik3r2 A G 8: 70,768,815 S682P probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plagl1 A G 10: 13,128,722 Q578R unknown Het
Ppp1r42 A G 1: 10,003,338 I9T probably benign Het
Ptcd3 A T 6: 71,894,291 I315K possibly damaging Het
Rnf217 A G 10: 31,608,406 L260P probably damaging Het
Selp A T 1: 164,141,406 H525L possibly damaging Het
Sh3rf2 T A 18: 42,111,282 M303K probably benign Het
Shprh A T 10: 11,206,332 I1549F probably damaging Het
Slc38a7 G T 8: 95,844,144 A244D probably benign Het
Stxbp6 G T 12: 44,902,957 T63K probably damaging Het
Syne3 A G 12: 104,932,209 S962P probably damaging Het
Syt10 T C 15: 89,826,932 I133V probably damaging Het
Tcaf3 A T 6: 42,589,702 W818R probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tldc1 T C 8: 119,761,775 E436G probably damaging Het
Tmem70 A C 1: 16,665,435 E43A probably benign Het
Trim72 C A 7: 128,009,920 A298E probably damaging Het
Washc5 C T 15: 59,346,213 probably null Het
Zfp707 C A 15: 75,975,236 F378L possibly damaging Het
Zfp839 G A 12: 110,855,846 A365T probably damaging Het
Other mutations in Tars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Tars APN 15 11388221 splice site probably null
IGL00642:Tars APN 15 11394372 missense probably damaging 1.00
IGL01315:Tars APN 15 11389734 nonsense probably null
IGL01459:Tars APN 15 11391854 missense possibly damaging 0.76
IGL02141:Tars APN 15 11391194 missense probably damaging 0.96
IGL03292:Tars APN 15 11384021 missense probably benign 0.22
R0383:Tars UTSW 15 11390325 missense probably benign
R0517:Tars UTSW 15 11394366 nonsense probably null
R0685:Tars UTSW 15 11385173 missense probably benign
R1589:Tars UTSW 15 11388175 missense probably benign 0.32
R1753:Tars UTSW 15 11394243 nonsense probably null
R2051:Tars UTSW 15 11393194 nonsense probably null
R2060:Tars UTSW 15 11394373 missense probably benign 0.03
R2216:Tars UTSW 15 11389708 missense probably benign 0.00
R3610:Tars UTSW 15 11392904 missense probably damaging 0.99
R4656:Tars UTSW 15 11394264 missense probably damaging 1.00
R4844:Tars UTSW 15 11385195 missense possibly damaging 0.85
R4974:Tars UTSW 15 11390391 missense probably damaging 1.00
R5551:Tars UTSW 15 11391982 missense probably damaging 0.97
R5992:Tars UTSW 15 11397196 missense probably damaging 1.00
R6742:Tars UTSW 15 11394341 missense probably damaging 0.98
R6778:Tars UTSW 15 11389699 missense probably benign 0.06
R6850:Tars UTSW 15 11392799 missense probably benign
R7270:Tars UTSW 15 11392019 missense probably benign 0.00
R7401:Tars UTSW 15 11392009 nonsense probably null
R7743:Tars UTSW 15 11399372 splice site probably null
R8062:Tars UTSW 15 11388314 missense possibly damaging 0.78
R8852:Tars UTSW 15 11393262 missense probably benign 0.02
R8942:Tars UTSW 15 11384097 missense probably benign 0.27
R9205:Tars UTSW 15 11397179 critical splice donor site probably null
R9362:Tars UTSW 15 11387530 missense probably damaging 1.00
Z1088:Tars UTSW 15 11391884 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AATACTATCAGGATGTGCTGGC -3'
(R):5'- ATGCCAGTGACCATTGTGATC -3'

Sequencing Primer
(F):5'- ATACTATCAGGATGTGCTGGCATGAC -3'
(R):5'- GACCATTGTGATCTGTGAAGCAATC -3'
Posted On 2022-10-06