Mutagenetix > Incidental Mutation

Incidental Mutation 'R9670:Dock8'

728024

Institutional Source

Beutler Lab

Gene Symbol

Dock8

Ensembl Gene

ENSMUSG00000052085

Gene Name

dedicator of cytokinesis 8

Synonyms

A130095G14Rik, 5830472H07Rik, 1200017A24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R9670 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24999529-25202432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25171562 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1468 (N1468S)

Ref Sequence

ENSEMBL: ENSMUSP00000025831 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025831]

AlphaFold

Q8C147

PDB Structure

Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000025831
AA Change: N1468S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: N1468S

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,133	T28A	probably benign	Het
Adam15	T	C	3: 89,345,963	I220V	probably benign	Het
Atf7ip2	T	A	16: 10,240,648	V317E	probably benign	Het
Bin3	T	G	14: 70,129,560		probably null	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Brd2	T	C	17: 34,115,231	T286A	possibly damaging	Het
Cers6	A	G	2: 69,002,770	Y144C	probably benign	Het
Cox4i2	C	A	2: 152,760,690	N101K	probably damaging	Het
Dguok	T	A	6: 83,487,017	L186F	probably benign	Het
Eral1	T	C	11: 78,074,584	H335R		Het
Gm3248	A	T	14: 5,944,993	I63K	probably benign	Het
Gm3415	A	C	5: 146,556,566	I74L	probably benign	Het
Kdm5b	A	T	1: 134,630,502	R1416*	probably null	Het
Lrit2	T	A	14: 37,068,158	C28*	probably null	Het
Mctp1	A	T	13: 76,384,721	T63S	probably benign	Het
Ncbp3	T	A	11: 73,053,497	N108K	possibly damaging	Het
Nlrp4b	A	G	7: 10,714,724	I285V	probably benign	Het
Nup85	C	T	11: 115,566,645	R58W	probably benign	Het
Pcnx4	T	C	12: 72,567,018	V579A	probably benign	Het
Pde10a	T	C	17: 8,801,440	S70P	unknown	Het
Pfpl	T	C	19: 12,429,743	F453L	probably damaging	Het
Ppp3cb	C	A	14: 20,528,246	L145F	probably damaging	Het
Prg4	T	C	1: 150,450,867	K357R	probably benign	Het
Prkcb	G	T	7: 122,633,847	E656*	probably null	Het
Prrc2b	C	A	2: 32,213,187	H892Q	probably benign	Het
Pxk	T	C	14: 8,140,748		probably null	Het
Ruvbl1	T	C	6: 88,467,576	V51A	probably benign	Het
Ryr3	C	A	2: 112,730,500	R2972L	probably benign	Het
Sec14l1	A	G	11: 117,155,232	I542V	possibly damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sgk1	AAGA	AAGAGA	10: 21,992,391		probably null	Het
Slc26a9	C	A	1: 131,753,950	A167E	probably benign	Het
Tarbp1	A	T	8: 126,456,523	L519Q	probably null	Het
Trak2	G	A	1: 58,946,304	R12*	probably null	Het
Ush2a	A	G	1: 188,628,571	I2163V	probably benign	Het
Vmn2r114	T	A	17: 23,312,124	N64Y		Het
Wdfy4	T	C	14: 33,047,262	Y2236C		Het
Zfp316	A	T	5: 143,254,593	V557E	possibly damaging	Het

Other mutations in Dock8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
captain_morgan	APN	19	25127711	critical splice donor site	probably benign
primurus	APN	19	25183609	missense	probably damaging	1.00
IGL00737:Dock8	APN	19	25182976	missense	probably benign	0.00
IGL00755:Dock8	APN	19	25051509	missense	probably benign	0.09
IGL00822:Dock8	APN	19	25188409	nonsense	probably null
IGL00838:Dock8	APN	19	25175459	nonsense	probably null
IGL01419:Dock8	APN	19	25119452	missense	probably benign	0.08
IGL01456:Dock8	APN	19	25119499	missense	possibly damaging	0.95
IGL01532:Dock8	APN	19	25169441	missense	probably damaging	0.99
IGL01602:Dock8	APN	19	25089888	splice site	probably benign
IGL01605:Dock8	APN	19	25089888	splice site	probably benign
IGL01753:Dock8	APN	19	25061292	splice site	probably benign
IGL01843:Dock8	APN	19	25089928	missense	probably benign	0.02
IGL02032:Dock8	APN	19	25130405	missense	probably damaging	0.99
IGL02073:Dock8	APN	19	25200986	critical splice acceptor site	probably null
IGL02192:Dock8	APN	19	25078205	critical splice donor site	probably null
IGL02402:Dock8	APN	19	25078145	missense	probably benign	0.25
IGL02529:Dock8	APN	19	25100926	nonsense	probably null
IGL02728:Dock8	APN	19	25132220	missense	probably benign
IGL02739:Dock8	APN	19	25188488	missense	probably damaging	1.00
IGL03037:Dock8	APN	19	25086181	missense	probably benign	0.02
IGL03104:Dock8	APN	19	25201020	nonsense	probably null
IGL03137:Dock8	APN	19	25155948	missense	probably benign	0.19
IGL03365:Dock8	APN	19	25099684	missense	possibly damaging	0.70
Defenseless	UTSW	19	25051563	missense	probably benign	0.00
Guardate	UTSW	19	25149831	missense	probably benign
hillock	UTSW	19	25174333	critical splice donor site	probably null
Molehill	UTSW	19	25130461	missense	probably damaging	1.00
Pap	UTSW	19	25122441	missense	probably benign	0.31
Papilla	UTSW	19	25078084	nonsense	probably null
snowdrop	UTSW	19	25184941	critical splice donor site	probably null
warts_and_all	UTSW	19	25169501	critical splice donor site	probably null
R0021:Dock8	UTSW	19	25163047	missense	probably benign	0.01
R0147:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0148:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0294:Dock8	UTSW	19	25188350	missense	probably damaging	1.00
R0537:Dock8	UTSW	19	25171577	missense	probably benign	0.08
R0630:Dock8	UTSW	19	25061160	missense	probably benign	0.10
R1163:Dock8	UTSW	19	25051503	missense	probably benign
R1164:Dock8	UTSW	19	25090027	missense	probably benign	0.44
R1471:Dock8	UTSW	19	25201036	missense	possibly damaging	0.74
R1477:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R1633:Dock8	UTSW	19	25051563	missense	probably benign	0.00
R1803:Dock8	UTSW	19	25132235	missense	probably benign	0.00
R1822:Dock8	UTSW	19	25161058	missense	probably benign	0.31
R1852:Dock8	UTSW	19	25127128	missense	probably benign	0.45
R1916:Dock8	UTSW	19	25061157	missense	probably benign	0.02
R1984:Dock8	UTSW	19	25121181	missense	probably null
R2311:Dock8	UTSW	19	25183004	missense	possibly damaging	0.93
R2341:Dock8	UTSW	19	25200393	missense	probably damaging	0.99
R2483:Dock8	UTSW	19	25079877	missense	probably benign
R3116:Dock8	UTSW	19	25188494	missense	probably benign	0.00
R3157:Dock8	UTSW	19	25149831	missense	probably benign
R3623:Dock8	UTSW	19	25079877	missense	probably benign
R3624:Dock8	UTSW	19	25079877	missense	probably benign
R3800:Dock8	UTSW	19	25164352	missense	probably benign	0.08
R3844:Dock8	UTSW	19	25065430	nonsense	probably null
R3895:Dock8	UTSW	19	25051501	missense	probably benign	0.31
R3901:Dock8	UTSW	19	25100905	missense	possibly damaging	0.69
R3959:Dock8	UTSW	19	25184941	critical splice donor site	probably null
R4428:Dock8	UTSW	19	25200499	missense	probably damaging	0.98
R4428:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4429:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4431:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4545:Dock8	UTSW	19	25188358	missense	probably damaging	1.00
R4839:Dock8	UTSW	19	25169494	missense	probably benign	0.00
R4897:Dock8	UTSW	19	25181637	missense	probably benign	0.00
R4939:Dock8	UTSW	19	25122400	missense	probably damaging	1.00
R4995:Dock8	UTSW	19	25158383	missense	probably benign	0.02
R5035:Dock8	UTSW	19	25086207	missense	probably damaging	0.99
R5294:Dock8	UTSW	19	25061153	missense	probably benign	0.01
R5324:Dock8	UTSW	19	25163094	missense	probably benign	0.17
R5478:Dock8	UTSW	19	25079822	missense	probably benign
R5704:Dock8	UTSW	19	25174222	missense	probably damaging	1.00
R5724:Dock8	UTSW	19	25122421	missense	probably damaging	1.00
R5745:Dock8	UTSW	19	25130397	missense	probably benign	0.02
R5864:Dock8	UTSW	19	25061220	missense	probably damaging	0.99
R5870:Dock8	UTSW	19	25132126	missense	probably benign
R5893:Dock8	UTSW	19	25122447	missense	probably damaging	1.00
R5954:Dock8	UTSW	19	25171619	missense	probably damaging	1.00
R6087:Dock8	UTSW	19	25161074	missense	probably benign	0.00
R6223:Dock8	UTSW	19	25161052	missense	probably benign	0.00
R6391:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R6759:Dock8	UTSW	19	25127484	missense	probably damaging	0.99
R6786:Dock8	UTSW	19	25183022	missense	possibly damaging	0.49
R6794:Dock8	UTSW	19	25122441	missense	probably benign	0.31
R6818:Dock8	UTSW	19	25169501	critical splice donor site	probably null
R6885:Dock8	UTSW	19	25147378	missense	possibly damaging	0.95
R6908:Dock8	UTSW	19	25188382	missense	probably damaging	1.00
R6923:Dock8	UTSW	19	25095606	missense	probably benign
R7001:Dock8	UTSW	19	25099677	missense	probably benign
R7141:Dock8	UTSW	19	25181620	missense	probably null	0.75
R7203:Dock8	UTSW	19	25181563	missense	probably damaging	1.00
R7257:Dock8	UTSW	19	25127085	missense	probably benign	0.08
R7296:Dock8	UTSW	19	25184881	missense	probably benign	0.00
R7538:Dock8	UTSW	19	25158418	missense	probably damaging	1.00
R7555:Dock8	UTSW	19	25175400	missense	probably damaging	0.99
R7641:Dock8	UTSW	19	25174333	critical splice donor site	probably null
R7764:Dock8	UTSW	19	25097535	missense	probably benign
R7859:Dock8	UTSW	19	25183570	missense	probably damaging	1.00
R7864:Dock8	UTSW	19	25163500	missense	possibly damaging	0.95
R8090:Dock8	UTSW	19	25154242	missense	probably damaging	1.00
R8160:Dock8	UTSW	19	25147347	missense	probably damaging	1.00
R8287:Dock8	UTSW	19	25130461	missense	probably damaging	1.00
R8295:Dock8	UTSW	19	25123236	missense	probably benign	0.04
R8443:Dock8	UTSW	19	25155917	missense	probably benign	0.04
R8537:Dock8	UTSW	19	25130506	missense	probably benign	0.00
R8673:Dock8	UTSW	19	25183503	missense	probably damaging	0.96
R8709:Dock8	UTSW	19	25078084	nonsense	probably null
R8834:Dock8	UTSW	19	25163470	missense	probably benign	0.16
R8991:Dock8	UTSW	19	25188367	missense	possibly damaging	0.82
R9292:Dock8	UTSW	19	25183631	splice site	probably benign
R9509:Dock8	UTSW	19	25095621	missense	probably benign	0.00
R9526:Dock8	UTSW	19	25188375	missense	probably benign	0.10
R9622:Dock8	UTSW	19	25121181	missense	probably null
R9634:Dock8	UTSW	19	25192221	missense	probably damaging	1.00
R9654:Dock8	UTSW	19	25147346	missense	probably damaging	1.00
R9699:Dock8	UTSW	19	25156024	critical splice donor site	probably null
R9726:Dock8	UTSW	19	25177010	missense	probably damaging	0.97
R9765:Dock8	UTSW	19	25169468	missense	possibly damaging	0.94
X0027:Dock8	UTSW	19	25161129	missense	probably benign
Z1177:Dock8	UTSW	19	25132123	missense	probably benign	0.05
Z1177:Dock8	UTSW	19	25155972	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AGCTTACGCTCTCATGGTGG -3'
(R):5'- CTGCATGACGTCTGATCTGC -3'

Sequencing Primer
(F):5'- ACGCTCTCATGGTGGTTAATGAAC -3'
(R):5'- GCATGACGTCTGATCTGCTTACAG -3'

Posted On

2022-10-06