Incidental Mutation 'R9672:Scel'
ID 728116
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9672 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103599402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 495 (N495K)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect possibly damaging
Transcript: ENSMUST00000095576
AA Change: N495K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: N495K

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000227322
AA Change: N475K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,002,729 K612N probably null Het
Atrnl1 G A 19: 57,630,263 A138T possibly damaging Het
Bicc1 T C 10: 70,958,836 T164A probably damaging Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Ccdc7a A G 8: 128,944,535 S497P unknown Het
Cd209d C G 8: 3,872,036 G212A probably damaging Het
Cog8 A G 8: 107,054,026 I200T probably damaging Het
Cuzd1 T A 7: 131,318,118 I90F possibly damaging Het
Cyp4a30b T A 4: 115,459,379 C401S probably benign Het
Cyp4a31 T A 4: 115,570,225 N209K probably benign Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dcaf11 T A 14: 55,569,027 Y468* probably null Het
Dennd4a A G 9: 64,893,358 D926G probably benign Het
Dph7 T C 2: 24,965,594 L135P probably benign Het
Fcho2 A T 13: 98,732,670 C564* probably null Het
Gabrb2 G A 11: 42,421,380 G11R probably benign Het
Gas6 A G 8: 13,478,273 S187P probably benign Het
Gemin5 C T 11: 58,167,759 V93I probably benign Het
Gldn A T 9: 54,338,496 I444F probably damaging Het
Gm35339 T A 15: 76,356,177 V355E Het
Gmps T C 3: 63,990,329 V234A probably damaging Het
Hand1 A G 11: 57,831,690 S33P possibly damaging Het
Ice2 G A 9: 69,415,617 A465T probably benign Het
Irf9 T C 14: 55,604,672 S2P probably benign Het
Kpna7 C T 5: 145,007,966 M21I probably benign Het
Lig4 A G 8: 9,973,213 M189T probably damaging Het
Lrp1b T C 2: 40,889,279 T2698A Het
Med10 A G 13: 69,815,592 K104R probably benign Het
Mfsd14b A G 13: 65,112,506 W38R probably benign Het
Mrgpra2a A G 7: 47,426,742 F256S probably benign Het
Myo9a A G 9: 59,780,049 K146E probably benign Het
Oxgr1 T A 14: 120,022,042 Y251F probably damaging Het
Pabpc4 T C 4: 123,290,340 probably null Het
Pde8a A G 7: 81,292,266 N151S probably damaging Het
Pdilt A G 7: 119,501,601 F176L possibly damaging Het
Plekhg5 C A 4: 152,103,084 D115E probably benign Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Ppp1r9a T C 6: 5,007,889 C532R unknown Het
Rasa2 A G 9: 96,545,728 W695R probably damaging Het
Rbpms2 A G 9: 65,630,836 N3S probably benign Het
Rsph6a A G 7: 19,065,917 Y491C probably damaging Het
Setd1a T C 7: 127,786,065 L648P possibly damaging Het
Snx29 A T 16: 11,660,651 R333S probably benign Het
Sppl2c A G 11: 104,186,518 Y48C probably damaging Het
Uba2 A T 7: 34,157,324 N230K probably benign Het
Utrn T C 10: 12,727,869 Q589R possibly damaging Het
Vmn1r51 T A 6: 90,129,567 L155H probably damaging Het
Vmn2r97 A G 17: 18,929,180 N277D probably benign Het
Yy1 C A 12: 108,793,658 H82Q unknown Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GAGAATCAAACCCAGGATTGC -3'
(R):5'- AAGTAACAGGACTGAGCCAC -3'

Sequencing Primer
(F):5'- GGATTGCCAAGCATGCTATC -3'
(R):5'- AATGTCATTCAAGCCCCC -3'
Posted On 2022-10-06