Incidental Mutation 'R9673:Csmd2'
ID 728136
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R9673 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128308062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1273 (H1273Q)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,244,399 (GRCm39) K318E probably benign Het
Ap5z1 T C 5: 142,463,113 (GRCm39) F766L probably benign Het
Atrnl1 A G 19: 57,599,786 (GRCm39) M1V probably null Het
Atxn1 T C 13: 45,710,622 (GRCm39) E770G probably benign Het
Brwd1 T G 16: 95,813,096 (GRCm39) I1471L probably benign Het
Bud23 T C 5: 135,082,571 (GRCm39) E66G probably benign Het
Cdh8 T A 8: 99,757,367 (GRCm39) I744L possibly damaging Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cep95 C A 11: 106,703,322 (GRCm39) H467Q probably benign Het
Chd1 A G 17: 15,989,023 (GRCm39) Y1592C probably benign Het
Chkb C G 15: 89,313,628 (GRCm39) G59A probably damaging Het
Copa A G 1: 171,945,648 (GRCm39) S915G probably benign Het
Creb3 G T 4: 43,563,191 (GRCm39) V97F probably damaging Het
Cxcr1 T C 1: 74,231,074 (GRCm39) N316S probably benign Het
Cyct A T 2: 76,184,523 (GRCm39) I76N probably damaging Het
Dmxl2 G T 9: 54,294,840 (GRCm39) R2412S probably damaging Het
Dnah11 A G 12: 117,982,513 (GRCm39) M2552T possibly damaging Het
Dnph1 G A 17: 46,809,901 (GRCm39) E148K possibly damaging Het
Ecpas T C 4: 58,822,060 (GRCm39) N1169S probably benign Het
Esp16 T A 17: 39,848,731 (GRCm39) Y8* probably null Het
Fam186a T C 15: 99,841,024 (GRCm39) D1740G possibly damaging Het
Fam76a C A 4: 132,628,557 (GRCm39) K300N probably damaging Het
Fcgbpl1 A G 7: 27,856,044 (GRCm39) T1944A probably benign Het
Frrs1l A C 4: 56,990,191 (GRCm39) D27E Het
G6pc1 T C 11: 101,267,380 (GRCm39) S277P probably damaging Het
Gabrg3 T A 7: 56,973,422 (GRCm39) I82F probably damaging Het
Gm3604 G T 13: 62,517,969 (GRCm39) Q130K probably benign Het
Hhip T A 8: 80,719,108 (GRCm39) D473V probably damaging Het
Ifi209 T C 1: 173,470,332 (GRCm39) S307P probably damaging Het
Ino80c C T 18: 24,254,856 (GRCm39) M1I probably null Het
Jag2 G T 12: 112,875,416 (GRCm39) C872* probably null Het
Kcnma1 A C 14: 23,558,123 (GRCm39) H474Q probably benign Het
Krr1 G A 10: 111,818,963 (GRCm39) probably null Het
Lats1 T G 10: 7,588,387 (GRCm39) D1001E probably benign Het
Lilrb4b T C 10: 51,357,753 (GRCm39) L149P probably benign Het
Lrrk2 T A 15: 91,649,884 (GRCm39) S1674T probably damaging Het
Magi2 A G 5: 20,670,582 (GRCm39) I309V possibly damaging Het
Mtmr4 A G 11: 87,503,138 (GRCm39) D1064G probably damaging Het
Mtmr4 T C 11: 87,504,916 (GRCm39) V1137A probably damaging Het
Neb C T 2: 52,133,853 (GRCm39) probably null Het
Nhsl1 T A 10: 18,402,665 (GRCm39) V1297E possibly damaging Het
Nlrp3 T A 11: 59,440,148 (GRCm39) V575D probably damaging Het
Nptx2 T C 5: 144,492,159 (GRCm39) I312T possibly damaging Het
Osm A G 11: 4,189,926 (GRCm39) T237A probably benign Het
Pcdha12 T C 18: 37,155,234 (GRCm39) V651A possibly damaging Het
Pclo A G 5: 14,908,758 (GRCm39) probably null Het
Pdlim3 C T 8: 46,368,195 (GRCm39) S183L possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pgm2 T A 5: 64,273,671 (GRCm39) M552K probably damaging Het
Pkhd1l1 T C 15: 44,386,901 (GRCm39) L1258S probably benign Het
Proser3 T G 7: 30,248,530 (GRCm39) T55P probably damaging Het
Ranbp2 C A 10: 58,300,963 (GRCm39) P611Q probably damaging Het
Rangap1 T C 15: 81,590,637 (GRCm39) D485G probably benign Het
Rp1 G A 1: 4,337,792 (GRCm39) T421I unknown Het
Ryr3 G A 2: 112,486,883 (GRCm39) L3862F possibly damaging Het
Sbf1 C T 15: 89,179,675 (GRCm39) G1337R possibly damaging Het
Setd2 A G 9: 110,378,138 (GRCm39) E651G probably damaging Het
Shmt1 A G 11: 60,692,769 (GRCm39) W105R probably damaging Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc22a29 T C 19: 8,140,104 (GRCm39) I434V probably benign Het
Sord C T 2: 122,090,712 (GRCm39) T221I probably benign Het
Speer1g T A 5: 11,178,990 (GRCm39) N55K probably benign Het
Tbcd T C 11: 121,464,647 (GRCm39) Y561H probably damaging Het
Tcaf1 G A 6: 42,663,808 (GRCm39) S24F probably benign Het
Tenm4 A T 7: 96,517,196 (GRCm39) D1429V probably damaging Het
Tesk1 A G 4: 43,444,574 (GRCm39) Y126C probably damaging Het
Tmem176a G A 6: 48,820,952 (GRCm39) V141I probably benign Het
Tmem204 A T 17: 25,299,243 (GRCm39) V92D probably damaging Het
Ttn T A 2: 76,572,605 (GRCm39) D26096V probably damaging Het
Vmn1r70 T A 7: 10,368,364 (GRCm39) L284Q probably damaging Het
Vmn2r77 T C 7: 86,450,171 (GRCm39) V139A possibly damaging Het
Wdpcp A G 11: 21,671,285 (GRCm39) R509G possibly damaging Het
Wee1 C T 7: 109,725,210 (GRCm39) T284I probably damaging Het
Wfs1 A G 5: 37,125,113 (GRCm39) S593P probably damaging Het
Zbtb11 A G 16: 55,827,336 (GRCm39) H934R probably damaging Het
Zfp277 A T 12: 40,370,611 (GRCm39) V446E probably benign Het
Zfp874a C A 13: 67,591,156 (GRCm39) R176L probably benign Het
Znrf2 A T 6: 54,840,978 (GRCm39) N184I probably damaging Het
Zp2 T A 7: 119,733,238 (GRCm39) T568S probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,411,542 (GRCm39) missense probably benign
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,445,828 (GRCm39) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,377,245 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,288,757 (GRCm39) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7823:Csmd2 UTSW 4 128,103,698 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8722:Csmd2 UTSW 4 128,445,743 (GRCm39) unclassified probably benign
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8839:Csmd2 UTSW 4 128,336,681 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9749:Csmd2 UTSW 4 128,389,921 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AATAGGGCTGGGTCAGGATC -3'
(R):5'- ATGCCCTCGTTGAAGTCAG -3'

Sequencing Primer
(F):5'- TCAGGATCCTGAGGCTGG -3'
(R):5'- CCTCGTTGAAGTCAGGGCTG -3'
Posted On 2022-10-06