Incidental Mutation 'R9673:Csmd2'
ID 728136
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # R9673 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 127987857-128567656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128414269 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1273 (H1273Q)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,387 K318E probably benign Het
9530053A07Rik A G 7: 28,156,619 T1944A probably benign Het
AI314180 T C 4: 58,822,060 N1169S probably benign Het
Ap5z1 T C 5: 142,477,358 F766L probably benign Het
Atrnl1 A G 19: 57,611,354 M1V probably null Het
Atxn1 T C 13: 45,557,146 E770G probably benign Het
Brwd1 T G 16: 96,011,896 I1471L probably benign Het
Bud23 T C 5: 135,053,717 E66G probably benign Het
Cdh8 T A 8: 99,030,735 I744L possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cep95 C A 11: 106,812,496 H467Q probably benign Het
Chd1 A G 17: 15,768,761 Y1592C probably benign Het
Chkb C G 15: 89,429,425 G59A probably damaging Het
Copa A G 1: 172,118,081 S915G probably benign Het
Creb3 G T 4: 43,563,191 V97F probably damaging Het
Cxcr1 T C 1: 74,191,915 N316S probably benign Het
Cyct A T 2: 76,354,179 I76N probably damaging Het
Dmxl2 G T 9: 54,387,556 R2412S probably damaging Het
Dnah11 A G 12: 118,018,778 M2552T possibly damaging Het
Dnph1 G A 17: 46,498,975 E148K possibly damaging Het
Esp16 T A 17: 39,537,840 Y8* probably null Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam76a C A 4: 132,901,246 K300N probably damaging Het
Frrs1l A C 4: 56,990,191 D27E Het
G6pc T C 11: 101,376,554 S277P probably damaging Het
Gabrg3 T A 7: 57,323,674 I82F probably damaging Het
Gm3604 G T 13: 62,370,155 Q130K probably benign Het
Gm8879 T A 5: 11,129,023 N55K probably benign Het
Hhip T A 8: 79,992,479 D473V probably damaging Het
Ifi209 T C 1: 173,642,766 S307P probably damaging Het
Ino80c C T 18: 24,121,799 M1I probably null Het
Jag2 G T 12: 112,911,796 C872* probably null Het
Kcnma1 A C 14: 23,508,055 H474Q probably benign Het
Krr1 G A 10: 111,983,058 probably null Het
Lats1 T G 10: 7,712,623 D1001E probably benign Het
Lilr4b T C 10: 51,481,657 L149P probably benign Het
Lrrk2 T A 15: 91,765,681 S1674T probably damaging Het
Magi2 A G 5: 20,465,584 I309V possibly damaging Het
Mtmr4 A G 11: 87,612,312 D1064G probably damaging Het
Mtmr4 T C 11: 87,614,090 V1137A probably damaging Het
Neb C T 2: 52,243,841 probably null Het
Nhsl1 T A 10: 18,526,917 V1297E possibly damaging Het
Nlrp3 T A 11: 59,549,322 V575D probably damaging Het
Nptx2 T C 5: 144,555,349 I312T possibly damaging Het
Osm A G 11: 4,239,926 T237A probably benign Het
Pcdha12 T C 18: 37,022,181 V651A possibly damaging Het
Pclo A G 5: 14,858,744 probably null Het
Pdlim3 C T 8: 45,915,158 S183L possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pgm1 T A 5: 64,116,328 M552K probably damaging Het
Pkhd1l1 T C 15: 44,523,505 L1258S probably benign Het
Proser3 T G 7: 30,549,105 T55P probably damaging Het
Ranbp2 C A 10: 58,465,141 P611Q probably damaging Het
Rangap1 T C 15: 81,706,436 D485G probably benign Het
Rp1 G A 1: 4,267,569 T421I unknown Het
Ryr3 G A 2: 112,656,538 L3862F possibly damaging Het
Sbf1 C T 15: 89,295,472 G1337R possibly damaging Het
Setd2 A G 9: 110,549,070 E651G probably damaging Het
Shmt1 A G 11: 60,801,943 W105R probably damaging Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc22a29 T C 19: 8,162,740 I434V probably benign Het
Sord C T 2: 122,260,231 T221I probably benign Het
Tbcd T C 11: 121,573,821 Y561H probably damaging Het
Tcaf1 G A 6: 42,686,874 S24F probably benign Het
Tenm4 A T 7: 96,867,989 D1429V probably damaging Het
Tesk1 A G 4: 43,444,574 Y126C probably damaging Het
Tmem176a G A 6: 48,844,018 V141I probably benign Het
Tmem204 A T 17: 25,080,269 V92D probably damaging Het
Ttn T A 2: 76,742,261 D26096V probably damaging Het
Vmn1r70 T A 7: 10,634,437 L284Q probably damaging Het
Vmn2r77 T C 7: 86,800,963 V139A possibly damaging Het
Wdpcp A G 11: 21,721,285 R509G possibly damaging Het
Wee1 C T 7: 110,126,003 T284I probably damaging Het
Wfs1 A G 5: 36,967,769 S593P probably damaging Het
Zbtb11 A G 16: 56,006,973 H934R probably damaging Het
Zfp277 A T 12: 40,320,612 V446E probably benign Het
Zfp874a C A 13: 67,443,037 R176L probably benign Het
Znrf2 A T 6: 54,863,993 N184I probably damaging Het
Zp2 T A 7: 120,134,015 T568S probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
R8704:Csmd2 UTSW 4 128197354 missense
R8722:Csmd2 UTSW 4 128551950 unclassified probably benign
R8729:Csmd2 UTSW 4 128462845 missense
R8801:Csmd2 UTSW 4 128563402 missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128546684 missense
R8839:Csmd2 UTSW 4 128442888 missense
R8867:Csmd2 UTSW 4 128557676 missense
R8913:Csmd2 UTSW 4 128523558 missense
R8928:Csmd2 UTSW 4 128475789 missense
R8974:Csmd2 UTSW 4 128552587 missense
R9001:Csmd2 UTSW 4 128414286 missense
R9132:Csmd2 UTSW 4 128549214 missense
R9245:Csmd2 UTSW 4 128306375 missense
R9249:Csmd2 UTSW 4 128419530 nonsense probably null
R9254:Csmd2 UTSW 4 128197319 missense
R9265:Csmd2 UTSW 4 128400370 missense
R9407:Csmd2 UTSW 4 128548820 missense
R9432:Csmd2 UTSW 4 128277211 missense
R9559:Csmd2 UTSW 4 128544768 missense
R9735:Csmd2 UTSW 4 128509108 missense
R9749:Csmd2 UTSW 4 128496128 missense
R9803:Csmd2 UTSW 4 128369193 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- AATAGGGCTGGGTCAGGATC -3'
(R):5'- ATGCCCTCGTTGAAGTCAG -3'

Sequencing Primer
(F):5'- TCAGGATCCTGAGGCTGG -3'
(R):5'- CCTCGTTGAAGTCAGGGCTG -3'
Posted On 2022-10-06