Incidental Mutation 'R9673:Osm'
ID 728168
Institutional Source Beutler Lab
Gene Symbol Osm
Ensembl Gene ENSMUSG00000058755
Gene Name oncostatin M
Synonyms OncoM
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9673 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 4236420-4241026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4239926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 237 (T237A)
Ref Sequence ENSEMBL: ENSMUSP00000074708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075221]
AlphaFold P53347
Predicted Effect probably benign
Transcript: ENSMUST00000075221
AA Change: T237A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074708
Gene: ENSMUSG00000058755
AA Change: T237A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LIF_OSM 28 183 7.44e-92 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 217 245 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leukemia inhibitory factor/oncostatin-M (LIF/OSM) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a secreted cytokine and growth regulator that inhibits the proliferation of a number of tumor cell lines. This protein also regulates the production of other cytokines, including interleukin 6, granulocyte-colony stimulating factor and granulocyte-macrophage colony stimulating factor in endothelial cells. This gene and the related gene, leukemia inhibitory factor, also present on chromosome 22, may have resulted from the duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice display decreased noxious responses in models of acute thermal, mechanical, chemical, and visceral pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,387 K318E probably benign Het
9530053A07Rik A G 7: 28,156,619 T1944A probably benign Het
AI314180 T C 4: 58,822,060 N1169S probably benign Het
Ap5z1 T C 5: 142,477,358 F766L probably benign Het
Atrnl1 A G 19: 57,611,354 M1V probably null Het
Atxn1 T C 13: 45,557,146 E770G probably benign Het
Brwd1 T G 16: 96,011,896 I1471L probably benign Het
Bud23 T C 5: 135,053,717 E66G probably benign Het
Cdh8 T A 8: 99,030,735 I744L possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cep95 C A 11: 106,812,496 H467Q probably benign Het
Chd1 A G 17: 15,768,761 Y1592C probably benign Het
Chkb C G 15: 89,429,425 G59A probably damaging Het
Copa A G 1: 172,118,081 S915G probably benign Het
Creb3 G T 4: 43,563,191 V97F probably damaging Het
Csmd2 T A 4: 128,414,269 H1273Q Het
Cxcr1 T C 1: 74,191,915 N316S probably benign Het
Cyct A T 2: 76,354,179 I76N probably damaging Het
Dmxl2 G T 9: 54,387,556 R2412S probably damaging Het
Dnah11 A G 12: 118,018,778 M2552T possibly damaging Het
Dnph1 G A 17: 46,498,975 E148K possibly damaging Het
Esp16 T A 17: 39,537,840 Y8* probably null Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam76a C A 4: 132,901,246 K300N probably damaging Het
Frrs1l A C 4: 56,990,191 D27E Het
G6pc T C 11: 101,376,554 S277P probably damaging Het
Gabrg3 T A 7: 57,323,674 I82F probably damaging Het
Gm3604 G T 13: 62,370,155 Q130K probably benign Het
Gm8879 T A 5: 11,129,023 N55K probably benign Het
Hhip T A 8: 79,992,479 D473V probably damaging Het
Ifi209 T C 1: 173,642,766 S307P probably damaging Het
Ino80c C T 18: 24,121,799 M1I probably null Het
Jag2 G T 12: 112,911,796 C872* probably null Het
Kcnma1 A C 14: 23,508,055 H474Q probably benign Het
Krr1 G A 10: 111,983,058 probably null Het
Lats1 T G 10: 7,712,623 D1001E probably benign Het
Lilr4b T C 10: 51,481,657 L149P probably benign Het
Lrrk2 T A 15: 91,765,681 S1674T probably damaging Het
Magi2 A G 5: 20,465,584 I309V possibly damaging Het
Mtmr4 A G 11: 87,612,312 D1064G probably damaging Het
Mtmr4 T C 11: 87,614,090 V1137A probably damaging Het
Neb C T 2: 52,243,841 probably null Het
Nhsl1 T A 10: 18,526,917 V1297E possibly damaging Het
Nlrp3 T A 11: 59,549,322 V575D probably damaging Het
Nptx2 T C 5: 144,555,349 I312T possibly damaging Het
Pcdha12 T C 18: 37,022,181 V651A possibly damaging Het
Pclo A G 5: 14,858,744 probably null Het
Pdlim3 C T 8: 45,915,158 S183L possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pgm1 T A 5: 64,116,328 M552K probably damaging Het
Pkhd1l1 T C 15: 44,523,505 L1258S probably benign Het
Proser3 T G 7: 30,549,105 T55P probably damaging Het
Ranbp2 C A 10: 58,465,141 P611Q probably damaging Het
Rangap1 T C 15: 81,706,436 D485G probably benign Het
Rp1 G A 1: 4,267,569 T421I unknown Het
Ryr3 G A 2: 112,656,538 L3862F possibly damaging Het
Sbf1 C T 15: 89,295,472 G1337R possibly damaging Het
Setd2 A G 9: 110,549,070 E651G probably damaging Het
Shmt1 A G 11: 60,801,943 W105R probably damaging Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc22a29 T C 19: 8,162,740 I434V probably benign Het
Sord C T 2: 122,260,231 T221I probably benign Het
Tbcd T C 11: 121,573,821 Y561H probably damaging Het
Tcaf1 G A 6: 42,686,874 S24F probably benign Het
Tenm4 A T 7: 96,867,989 D1429V probably damaging Het
Tesk1 A G 4: 43,444,574 Y126C probably damaging Het
Tmem176a G A 6: 48,844,018 V141I probably benign Het
Tmem204 A T 17: 25,080,269 V92D probably damaging Het
Ttn T A 2: 76,742,261 D26096V probably damaging Het
Vmn1r70 T A 7: 10,634,437 L284Q probably damaging Het
Vmn2r77 T C 7: 86,800,963 V139A possibly damaging Het
Wdpcp A G 11: 21,721,285 R509G possibly damaging Het
Wee1 C T 7: 110,126,003 T284I probably damaging Het
Wfs1 A G 5: 36,967,769 S593P probably damaging Het
Zbtb11 A G 16: 56,006,973 H934R probably damaging Het
Zfp277 A T 12: 40,320,612 V446E probably benign Het
Zfp874a C A 13: 67,443,037 R176L probably benign Het
Znrf2 A T 6: 54,863,993 N184I probably damaging Het
Zp2 T A 7: 120,134,015 T568S probably damaging Het
Other mutations in Osm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Osm APN 11 4239470 missense probably damaging 0.99
IGL02477:Osm APN 11 4239604 missense probably damaging 0.99
IGL02478:Osm APN 11 4239507 missense probably damaging 0.96
IGL02699:Osm APN 11 4239723 missense possibly damaging 0.45
IGL03328:Osm APN 11 4238426 missense unknown
R0212:Osm UTSW 11 4238465 missense probably benign 0.12
R0667:Osm UTSW 11 4239918 missense possibly damaging 0.53
R2237:Osm UTSW 11 4238505 missense possibly damaging 0.95
R4790:Osm UTSW 11 4238435 missense probably benign 0.01
R6621:Osm UTSW 11 4239541 missense probably benign 0.03
R7148:Osm UTSW 11 4239936 missense probably benign 0.02
R8669:Osm UTSW 11 4239665 missense probably benign 0.04
R8805:Osm UTSW 11 4239839 missense probably benign 0.18
R9205:Osm UTSW 11 4238504 missense possibly damaging 0.95
T0975:Osm UTSW 11 4239588 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCAAGATAGGCAGCTGTGG -3'
(R):5'- CCTTAAAGTGCTCTTCTGTGTGAC -3'

Sequencing Primer
(F):5'- CTGTGGCTTTCTCTGGGGATAC -3'
(R):5'- CTTCTGTGTGACCCCTGGTG -3'
Posted On 2022-10-06