Incidental Mutation 'R9673:Nlrp3'
ID 728170
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9673 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59440148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 575 (V575D)
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably damaging
Transcript: ENSMUST00000079476
AA Change: V575D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: V575D

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101148
AA Change: V575D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: V575D

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,244,399 (GRCm39) K318E probably benign Het
Ap5z1 T C 5: 142,463,113 (GRCm39) F766L probably benign Het
Atrnl1 A G 19: 57,599,786 (GRCm39) M1V probably null Het
Atxn1 T C 13: 45,710,622 (GRCm39) E770G probably benign Het
Brwd1 T G 16: 95,813,096 (GRCm39) I1471L probably benign Het
Bud23 T C 5: 135,082,571 (GRCm39) E66G probably benign Het
Cdh8 T A 8: 99,757,367 (GRCm39) I744L possibly damaging Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cep95 C A 11: 106,703,322 (GRCm39) H467Q probably benign Het
Chd1 A G 17: 15,989,023 (GRCm39) Y1592C probably benign Het
Chkb C G 15: 89,313,628 (GRCm39) G59A probably damaging Het
Copa A G 1: 171,945,648 (GRCm39) S915G probably benign Het
Creb3 G T 4: 43,563,191 (GRCm39) V97F probably damaging Het
Csmd2 T A 4: 128,308,062 (GRCm39) H1273Q Het
Cxcr1 T C 1: 74,231,074 (GRCm39) N316S probably benign Het
Cyct A T 2: 76,184,523 (GRCm39) I76N probably damaging Het
Dmxl2 G T 9: 54,294,840 (GRCm39) R2412S probably damaging Het
Dnah11 A G 12: 117,982,513 (GRCm39) M2552T possibly damaging Het
Dnph1 G A 17: 46,809,901 (GRCm39) E148K possibly damaging Het
Ecpas T C 4: 58,822,060 (GRCm39) N1169S probably benign Het
Esp16 T A 17: 39,848,731 (GRCm39) Y8* probably null Het
Fam186a T C 15: 99,841,024 (GRCm39) D1740G possibly damaging Het
Fam76a C A 4: 132,628,557 (GRCm39) K300N probably damaging Het
Fcgbpl1 A G 7: 27,856,044 (GRCm39) T1944A probably benign Het
Frrs1l A C 4: 56,990,191 (GRCm39) D27E Het
G6pc1 T C 11: 101,267,380 (GRCm39) S277P probably damaging Het
Gabrg3 T A 7: 56,973,422 (GRCm39) I82F probably damaging Het
Gm3604 G T 13: 62,517,969 (GRCm39) Q130K probably benign Het
Hhip T A 8: 80,719,108 (GRCm39) D473V probably damaging Het
Ifi209 T C 1: 173,470,332 (GRCm39) S307P probably damaging Het
Ino80c C T 18: 24,254,856 (GRCm39) M1I probably null Het
Jag2 G T 12: 112,875,416 (GRCm39) C872* probably null Het
Kcnma1 A C 14: 23,558,123 (GRCm39) H474Q probably benign Het
Krr1 G A 10: 111,818,963 (GRCm39) probably null Het
Lats1 T G 10: 7,588,387 (GRCm39) D1001E probably benign Het
Lilrb4b T C 10: 51,357,753 (GRCm39) L149P probably benign Het
Lrrk2 T A 15: 91,649,884 (GRCm39) S1674T probably damaging Het
Magi2 A G 5: 20,670,582 (GRCm39) I309V possibly damaging Het
Mtmr4 T C 11: 87,504,916 (GRCm39) V1137A probably damaging Het
Mtmr4 A G 11: 87,503,138 (GRCm39) D1064G probably damaging Het
Neb C T 2: 52,133,853 (GRCm39) probably null Het
Nhsl1 T A 10: 18,402,665 (GRCm39) V1297E possibly damaging Het
Nptx2 T C 5: 144,492,159 (GRCm39) I312T possibly damaging Het
Osm A G 11: 4,189,926 (GRCm39) T237A probably benign Het
Pcdha12 T C 18: 37,155,234 (GRCm39) V651A possibly damaging Het
Pclo A G 5: 14,908,758 (GRCm39) probably null Het
Pdlim3 C T 8: 46,368,195 (GRCm39) S183L possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pgm2 T A 5: 64,273,671 (GRCm39) M552K probably damaging Het
Pkhd1l1 T C 15: 44,386,901 (GRCm39) L1258S probably benign Het
Proser3 T G 7: 30,248,530 (GRCm39) T55P probably damaging Het
Ranbp2 C A 10: 58,300,963 (GRCm39) P611Q probably damaging Het
Rangap1 T C 15: 81,590,637 (GRCm39) D485G probably benign Het
Rp1 G A 1: 4,337,792 (GRCm39) T421I unknown Het
Ryr3 G A 2: 112,486,883 (GRCm39) L3862F possibly damaging Het
Sbf1 C T 15: 89,179,675 (GRCm39) G1337R possibly damaging Het
Setd2 A G 9: 110,378,138 (GRCm39) E651G probably damaging Het
Shmt1 A G 11: 60,692,769 (GRCm39) W105R probably damaging Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc22a29 T C 19: 8,140,104 (GRCm39) I434V probably benign Het
Sord C T 2: 122,090,712 (GRCm39) T221I probably benign Het
Speer1g T A 5: 11,178,990 (GRCm39) N55K probably benign Het
Tbcd T C 11: 121,464,647 (GRCm39) Y561H probably damaging Het
Tcaf1 G A 6: 42,663,808 (GRCm39) S24F probably benign Het
Tenm4 A T 7: 96,517,196 (GRCm39) D1429V probably damaging Het
Tesk1 A G 4: 43,444,574 (GRCm39) Y126C probably damaging Het
Tmem176a G A 6: 48,820,952 (GRCm39) V141I probably benign Het
Tmem204 A T 17: 25,299,243 (GRCm39) V92D probably damaging Het
Ttn T A 2: 76,572,605 (GRCm39) D26096V probably damaging Het
Vmn1r70 T A 7: 10,368,364 (GRCm39) L284Q probably damaging Het
Vmn2r77 T C 7: 86,450,171 (GRCm39) V139A possibly damaging Het
Wdpcp A G 11: 21,671,285 (GRCm39) R509G possibly damaging Het
Wee1 C T 7: 109,725,210 (GRCm39) T284I probably damaging Het
Wfs1 A G 5: 37,125,113 (GRCm39) S593P probably damaging Het
Zbtb11 A G 16: 55,827,336 (GRCm39) H934R probably damaging Het
Zfp277 A T 12: 40,370,611 (GRCm39) V446E probably benign Het
Zfp874a C A 13: 67,591,156 (GRCm39) R176L probably benign Het
Znrf2 A T 6: 54,840,978 (GRCm39) N184I probably damaging Het
Zp2 T A 7: 119,733,238 (GRCm39) T568S probably damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CTTCAGCCACATGACTTTCCAG -3'
(R):5'- AAAGTGGTCCATGGCACTCTG -3'

Sequencing Primer
(F):5'- AGCCACATGACTTTCCAGGAGTTC -3'
(R):5'- TGCATCTCGTACAGGCAGTAG -3'
Posted On 2022-10-06