Incidental Mutation 'R9673:Chd1'
ID 728193
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Name chromodomain helicase DNA binding protein 1
Synonyms 4930525N21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9673 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 15704967-15772610 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15768761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1592 (Y1592C)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627]
AlphaFold P40201
Predicted Effect probably benign
Transcript: ENSMUST00000024627
AA Change: Y1592C

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: Y1592C

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,387 K318E probably benign Het
9530053A07Rik A G 7: 28,156,619 T1944A probably benign Het
AI314180 T C 4: 58,822,060 N1169S probably benign Het
Ap5z1 T C 5: 142,477,358 F766L probably benign Het
Atrnl1 A G 19: 57,611,354 M1V probably null Het
Atxn1 T C 13: 45,557,146 E770G probably benign Het
Brwd1 T G 16: 96,011,896 I1471L probably benign Het
Bud23 T C 5: 135,053,717 E66G probably benign Het
Cdh8 T A 8: 99,030,735 I744L possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cep95 C A 11: 106,812,496 H467Q probably benign Het
Chkb C G 15: 89,429,425 G59A probably damaging Het
Copa A G 1: 172,118,081 S915G probably benign Het
Creb3 G T 4: 43,563,191 V97F probably damaging Het
Csmd2 T A 4: 128,414,269 H1273Q Het
Cxcr1 T C 1: 74,191,915 N316S probably benign Het
Cyct A T 2: 76,354,179 I76N probably damaging Het
Dmxl2 G T 9: 54,387,556 R2412S probably damaging Het
Dnah11 A G 12: 118,018,778 M2552T possibly damaging Het
Dnph1 G A 17: 46,498,975 E148K possibly damaging Het
Esp16 T A 17: 39,537,840 Y8* probably null Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam76a C A 4: 132,901,246 K300N probably damaging Het
Frrs1l A C 4: 56,990,191 D27E Het
G6pc T C 11: 101,376,554 S277P probably damaging Het
Gabrg3 T A 7: 57,323,674 I82F probably damaging Het
Gm3604 G T 13: 62,370,155 Q130K probably benign Het
Gm8879 T A 5: 11,129,023 N55K probably benign Het
Hhip T A 8: 79,992,479 D473V probably damaging Het
Ifi209 T C 1: 173,642,766 S307P probably damaging Het
Ino80c C T 18: 24,121,799 M1I probably null Het
Jag2 G T 12: 112,911,796 C872* probably null Het
Kcnma1 A C 14: 23,508,055 H474Q probably benign Het
Krr1 G A 10: 111,983,058 probably null Het
Lats1 T G 10: 7,712,623 D1001E probably benign Het
Lilr4b T C 10: 51,481,657 L149P probably benign Het
Lrrk2 T A 15: 91,765,681 S1674T probably damaging Het
Magi2 A G 5: 20,465,584 I309V possibly damaging Het
Mtmr4 A G 11: 87,612,312 D1064G probably damaging Het
Mtmr4 T C 11: 87,614,090 V1137A probably damaging Het
Neb C T 2: 52,243,841 probably null Het
Nhsl1 T A 10: 18,526,917 V1297E possibly damaging Het
Nlrp3 T A 11: 59,549,322 V575D probably damaging Het
Nptx2 T C 5: 144,555,349 I312T possibly damaging Het
Osm A G 11: 4,239,926 T237A probably benign Het
Pcdha12 T C 18: 37,022,181 V651A possibly damaging Het
Pclo A G 5: 14,858,744 probably null Het
Pdlim3 C T 8: 45,915,158 S183L possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pgm1 T A 5: 64,116,328 M552K probably damaging Het
Pkhd1l1 T C 15: 44,523,505 L1258S probably benign Het
Proser3 T G 7: 30,549,105 T55P probably damaging Het
Ranbp2 C A 10: 58,465,141 P611Q probably damaging Het
Rangap1 T C 15: 81,706,436 D485G probably benign Het
Rp1 G A 1: 4,267,569 T421I unknown Het
Ryr3 G A 2: 112,656,538 L3862F possibly damaging Het
Sbf1 C T 15: 89,295,472 G1337R possibly damaging Het
Setd2 A G 9: 110,549,070 E651G probably damaging Het
Shmt1 A G 11: 60,801,943 W105R probably damaging Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc22a29 T C 19: 8,162,740 I434V probably benign Het
Sord C T 2: 122,260,231 T221I probably benign Het
Tbcd T C 11: 121,573,821 Y561H probably damaging Het
Tcaf1 G A 6: 42,686,874 S24F probably benign Het
Tenm4 A T 7: 96,867,989 D1429V probably damaging Het
Tesk1 A G 4: 43,444,574 Y126C probably damaging Het
Tmem176a G A 6: 48,844,018 V141I probably benign Het
Tmem204 A T 17: 25,080,269 V92D probably damaging Het
Ttn T A 2: 76,742,261 D26096V probably damaging Het
Vmn1r70 T A 7: 10,634,437 L284Q probably damaging Het
Vmn2r77 T C 7: 86,800,963 V139A possibly damaging Het
Wdpcp A G 11: 21,721,285 R509G possibly damaging Het
Wee1 C T 7: 110,126,003 T284I probably damaging Het
Wfs1 A G 5: 36,967,769 S593P probably damaging Het
Zbtb11 A G 16: 56,006,973 H934R probably damaging Het
Zfp277 A T 12: 40,320,612 V446E probably benign Het
Zfp874a C A 13: 67,443,037 R176L probably benign Het
Znrf2 A T 6: 54,863,993 N184I probably damaging Het
Zp2 T A 7: 120,134,015 T568S probably damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
R9067:Chd1 UTSW 17 15730845 missense possibly damaging 0.49
R9184:Chd1 UTSW 17 15742289 missense possibly damaging 0.71
R9210:Chd1 UTSW 17 15730505 missense possibly damaging 0.70
R9212:Chd1 UTSW 17 15730505 missense possibly damaging 0.70
R9666:Chd1 UTSW 17 15735714 missense probably damaging 1.00
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAATCATGATGACAGTAGCAGG -3'
(R):5'- TGTACTTCCACCAACAAGCTG -3'

Sequencing Primer
(F):5'- GGGACAGCTATTCTTCTGACAGAC -3'
(R):5'- CCAACAAGCTGCACTATTTAAAATG -3'
Posted On 2022-10-06