Incidental Mutation 'R9674:Mmrn1'
ID 728225
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Name multimerin 1
Synonyms 4921530G03Rik, Emilin4
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9674 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 60924976-60989378 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 60971088 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 272 (Q272*)
Ref Sequence ENSEMBL: ENSMUSP00000119609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000129603
AA Change: Q272*
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: Q272*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204333
AA Change: Q272*
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: Q272*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,284,196 V4327I possibly damaging Het
Aadacl2 A T 3: 60,007,051 D25V possibly damaging Het
Abca16 A G 7: 120,475,445 probably null Het
Adam9 T A 8: 24,950,998 T820S possibly damaging Het
Adamts6 G A 13: 104,426,940 V647I probably benign Het
Afap1l2 T A 19: 56,933,763 R14S probably damaging Het
Aff3 C T 1: 38,209,783 V748I probably damaging Het
Aldh5a1 T C 13: 24,926,055 I166V probably benign Het
Alx4 G T 2: 93,677,513 L384F probably damaging Het
Ank3 T A 10: 69,988,719 S1073T Het
Ankrd50 A G 3: 38,452,425 C275R unknown Het
Apol11a G A 15: 77,517,147 S278N possibly damaging Het
Astn2 T A 4: 65,542,726 D1057V probably damaging Het
Atp11a T C 8: 12,827,525 V317A probably benign Het
Cacna1i A G 15: 80,380,428 T1486A probably damaging Het
Cadps A G 14: 12,454,291 F1076L probably damaging Het
Cct6b T C 11: 82,755,012 T154A probably damaging Het
Cfap69 A G 5: 5,647,021 F92L possibly damaging Het
Cyp19a1 A T 9: 54,166,857 I471K possibly damaging Het
Cyp26a1 T A 19: 37,701,278 M474K probably damaging Het
Cyp4a12a T C 4: 115,328,959 S439P probably benign Het
Cyp4f37 T A 17: 32,627,867 probably null Het
Dgki A G 6: 37,050,222 Y395H probably damaging Het
Dlg1 T C 16: 31,791,762 V287A probably damaging Het
Dlx2 C T 2: 71,546,152 G81S possibly damaging Het
Dnah8 G T 17: 30,779,138 K3448N possibly damaging Het
Dnhd1 C T 7: 105,714,222 P3997L probably damaging Het
Drosha C G 15: 12,890,084 D910E probably damaging Het
Dscam A G 16: 96,640,836 V1597A probably benign Het
Eif1b A G 9: 120,494,199 K42E possibly damaging Het
Enpp2 C A 15: 54,952,739 G10W unknown Het
Exd2 A G 12: 80,489,598 N334S probably benign Het
Glt6d1 T A 2: 25,794,370 N208I probably benign Het
Gm13023 T A 4: 143,793,592 H135Q probably benign Het
Grin2a T A 16: 9,653,401 K668* probably null Het
Grm1 A G 10: 10,733,284 V535A possibly damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hist1h2ad A G 13: 23,574,688 D73G possibly damaging Het
Ighm T A 12: 113,421,519 I274F Het
Ighv1-58 G T 12: 115,312,227 T97K probably damaging Het
Igkv6-20 T C 6: 70,335,868 H107R possibly damaging Het
Il15 C T 8: 82,343,309 G42D probably damaging Het
Jakmip2 T A 18: 43,571,896 M347L probably benign Het
Kcnh7 T C 2: 62,764,716 Y670C probably damaging Het
Ktn1 G C 14: 47,684,756 C458S possibly damaging Het
Lama5 C T 2: 180,198,474 probably null Het
Lce1i T C 3: 92,777,806 Q21R unknown Het
Lmo7 A T 14: 101,840,904 E81D probably damaging Het
Lrrc4b A T 7: 44,462,428 I575F probably damaging Het
Nbea A T 3: 56,058,762 D426E probably damaging Het
Neto1 G A 18: 86,473,702 V243M probably damaging Het
Notch1 G A 2: 26,471,296 R1061C probably damaging Het
Olfr1002 T G 2: 85,648,249 Q24P possibly damaging Het
Olfr492 A T 7: 108,323,064 I204N probably benign Het
Osgin1 A G 8: 119,445,760 D431G possibly damaging Het
Ppp4r1 A G 17: 65,833,132 D675G probably damaging Het
Prkdc T A 16: 15,715,955 H1552Q probably damaging Het
Rbfox1 T C 16: 7,353,021 F282L probably benign Het
Ret T C 6: 118,153,869 D1111G probably damaging Het
Rnf224 A T 2: 25,236,318 Y8N probably benign Het
Rtl1 G T 12: 109,592,590 H938Q possibly damaging Het
Sec23ip T G 7: 128,778,463 D867E probably damaging Het
Sema3f A T 9: 107,689,748 L194Q possibly damaging Het
Sfmbt1 C T 14: 30,773,894 R45C probably damaging Het
Slc7a4 T C 16: 17,574,344 I409V probably benign Het
Slco6c1 T A 1: 97,119,840 D246V probably damaging Het
Smap2 C T 4: 120,969,548 M426I probably benign Het
Tmem184b T A 15: 79,365,324 T315S probably benign Het
Trpm4 A T 7: 45,333,387 D30E possibly damaging Het
Ttc7b T A 12: 100,466,294 K154N probably benign Het
Vps13b T A 15: 35,607,234 H1104Q probably damaging Het
Wnk4 T A 11: 101,276,048 L1010Q unknown Het
Xpo6 T A 7: 126,124,528 H537L probably benign Het
Xrn1 A T 9: 95,973,592 Y314F probably damaging Het
Xrn1 A T 9: 95,973,594 I315F possibly damaging Het
Zap70 T C 1: 36,771,069 Y87H probably benign Het
Zbtb4 T C 11: 69,779,147 Y899H probably damaging Het
Zcchc7 T A 4: 44,931,418 H202Q possibly damaging Het
Zeb2 A G 2: 45,001,713 Y276H probably damaging Het
Zfp867 T G 11: 59,465,024 Q68P probably benign Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60987060 splice site probably null
R7979:Mmrn1 UTSW 6 60975977 missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60944524 start gained probably benign
R8130:Mmrn1 UTSW 6 60960723 missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60977236 missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8472:Mmrn1 UTSW 6 60988396 missense probably damaging 1.00
R8758:Mmrn1 UTSW 6 60987209 missense possibly damaging 0.54
R8803:Mmrn1 UTSW 6 60988287 missense probably damaging 1.00
R8879:Mmrn1 UTSW 6 60976529 missense probably damaging 0.99
R8907:Mmrn1 UTSW 6 60976093 missense probably damaging 1.00
R8983:Mmrn1 UTSW 6 60976058 missense probably benign 0.04
R9200:Mmrn1 UTSW 6 60976876 missense probably damaging 1.00
R9287:Mmrn1 UTSW 6 60975955 missense probably damaging 1.00
R9387:Mmrn1 UTSW 6 60958192 nonsense probably null
R9612:Mmrn1 UTSW 6 60976424 missense probably damaging 0.96
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATGTGGCATTACCCTGTCC -3'
(R):5'- TTCTACCTGGAACATGAAACCC -3'

Sequencing Primer
(F):5'- GTGGCATTACCCTGTCCTACAGATG -3'
(R):5'- ACAGAACTGAGAAGCATGTTAATCC -3'
Posted On 2022-10-06