Incidental Mutation 'R9674:Ret'
ID 728227
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R9674 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118130830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1111 (D1111G)
Ref Sequence ENSEMBL: ENSMUSP00000032201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
PDB Structure Crystal Structure of Dok1 PTB Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032201
AA Change: D1111G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: D1111G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088790
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 59,914,472 (GRCm39) D25V possibly damaging Het
Abca16 A G 7: 120,074,668 (GRCm39) probably null Het
Adam9 T A 8: 25,441,014 (GRCm39) T820S possibly damaging Het
Adamts6 G A 13: 104,563,448 (GRCm39) V647I probably benign Het
Afap1l2 T A 19: 56,922,195 (GRCm39) R14S probably damaging Het
Aff3 C T 1: 38,248,864 (GRCm39) V748I probably damaging Het
Aldh5a1 T C 13: 25,110,038 (GRCm39) I166V probably benign Het
Alx4 G T 2: 93,507,858 (GRCm39) L384F probably damaging Het
Ank3 T A 10: 69,824,549 (GRCm39) S1073T Het
Ankrd50 A G 3: 38,506,574 (GRCm39) C275R unknown Het
Apol11a G A 15: 77,401,347 (GRCm39) S278N possibly damaging Het
Astn2 T A 4: 65,460,963 (GRCm39) D1057V probably damaging Het
Atp11a T C 8: 12,877,525 (GRCm39) V317A probably benign Het
Cacna1i A G 15: 80,264,629 (GRCm39) T1486A probably damaging Het
Cadps A G 14: 12,454,291 (GRCm38) F1076L probably damaging Het
Cct6b T C 11: 82,645,838 (GRCm39) T154A probably damaging Het
Cfap69 A G 5: 5,697,021 (GRCm39) F92L possibly damaging Het
Cyp19a1 A T 9: 54,074,141 (GRCm39) I471K possibly damaging Het
Cyp26a1 T A 19: 37,689,726 (GRCm39) M474K probably damaging Het
Cyp4a12a T C 4: 115,186,156 (GRCm39) S439P probably benign Het
Cyp4f37 T A 17: 32,846,841 (GRCm39) probably null Het
Dgki A G 6: 37,027,157 (GRCm39) Y395H probably damaging Het
Dlg1 T C 16: 31,610,580 (GRCm39) V287A probably damaging Het
Dlx2 C T 2: 71,376,496 (GRCm39) G81S possibly damaging Het
Dnah8 G T 17: 30,998,112 (GRCm39) K3448N possibly damaging Het
Dnhd1 C T 7: 105,363,429 (GRCm39) P3997L probably damaging Het
Drosha C G 15: 12,890,170 (GRCm39) D910E probably damaging Het
Dscam A G 16: 96,442,036 (GRCm39) V1597A probably benign Het
Eif1b A G 9: 120,323,265 (GRCm39) K42E possibly damaging Het
Enpp2 C A 15: 54,816,135 (GRCm39) G10W unknown Het
Exd2 A G 12: 80,536,372 (GRCm39) N334S probably benign Het
Glt6d1 T A 2: 25,684,382 (GRCm39) N208I probably benign Het
Grin2a T A 16: 9,471,265 (GRCm39) K668* probably null Het
Grm1 A G 10: 10,609,028 (GRCm39) V535A possibly damaging Het
H2ac7 A G 13: 23,758,862 (GRCm39) D73G possibly damaging Het
Hey2 A T 10: 30,710,413 (GRCm39) D113E probably benign Het
Ighm T A 12: 113,385,139 (GRCm39) I274F Het
Ighv1-58 G T 12: 115,275,847 (GRCm39) T97K probably damaging Het
Igkv6-20 T C 6: 70,312,852 (GRCm39) H107R possibly damaging Het
Il15 C T 8: 83,069,938 (GRCm39) G42D probably damaging Het
Jakmip2 T A 18: 43,704,961 (GRCm39) M347L probably benign Het
Kcnh7 T C 2: 62,595,060 (GRCm39) Y670C probably damaging Het
Ktn1 G C 14: 47,922,213 (GRCm39) C458S possibly damaging Het
Lama5 C T 2: 179,840,267 (GRCm39) probably null Het
Lce1i T C 3: 92,685,113 (GRCm39) Q21R unknown Het
Lmo7 A T 14: 102,078,340 (GRCm39) E81D probably damaging Het
Lrrc4b A T 7: 44,111,852 (GRCm39) I575F probably damaging Het
Mmrn1 C T 6: 60,948,072 (GRCm39) Q272* probably null Het
Nbea A T 3: 55,966,183 (GRCm39) D426E probably damaging Het
Neto1 G A 18: 86,491,827 (GRCm39) V243M probably damaging Het
Notch1 G A 2: 26,361,308 (GRCm39) R1061C probably damaging Het
Or5g25 T G 2: 85,478,593 (GRCm39) Q24P possibly damaging Het
Or5p67 A T 7: 107,922,271 (GRCm39) I204N probably benign Het
Osgin1 A G 8: 120,172,499 (GRCm39) D431G possibly damaging Het
Ppp4r1 A G 17: 66,140,127 (GRCm39) D675G probably damaging Het
Pramel25 T A 4: 143,520,162 (GRCm39) H135Q probably benign Het
Prkdc T A 16: 15,533,819 (GRCm39) H1552Q probably damaging Het
Rbfox1 T C 16: 7,170,885 (GRCm39) F282L probably benign Het
Rnf224 A T 2: 25,126,330 (GRCm39) Y8N probably benign Het
Rtl1 G T 12: 109,559,024 (GRCm39) H938Q possibly damaging Het
Sec23ip T G 7: 128,380,187 (GRCm39) D867E probably damaging Het
Sema3f A T 9: 107,566,947 (GRCm39) L194Q possibly damaging Het
Sfmbt1 C T 14: 30,495,851 (GRCm39) R45C probably damaging Het
Slc7a4 T C 16: 17,392,208 (GRCm39) I409V probably benign Het
Slco6c1 T A 1: 97,047,565 (GRCm39) D246V probably damaging Het
Smap2 C T 4: 120,826,745 (GRCm39) M426I probably benign Het
Spata31h1 C T 10: 82,120,030 (GRCm39) V4327I possibly damaging Het
Tmem184b T A 15: 79,249,524 (GRCm39) T315S probably benign Het
Trpm4 A T 7: 44,982,811 (GRCm39) D30E possibly damaging Het
Ttc7b T A 12: 100,432,553 (GRCm39) K154N probably benign Het
Vps13b T A 15: 35,607,380 (GRCm39) H1104Q probably damaging Het
Wnk4 T A 11: 101,166,874 (GRCm39) L1010Q unknown Het
Xpo6 T A 7: 125,723,700 (GRCm39) H537L probably benign Het
Xrn1 A T 9: 95,855,645 (GRCm39) Y314F probably damaging Het
Xrn1 A T 9: 95,855,647 (GRCm39) I315F possibly damaging Het
Zap70 T C 1: 36,810,150 (GRCm39) Y87H probably benign Het
Zbtb4 T C 11: 69,669,973 (GRCm39) Y899H probably damaging Het
Zcchc7 T A 4: 44,931,418 (GRCm39) H202Q possibly damaging Het
Zeb2 A G 2: 44,891,725 (GRCm39) Y276H probably damaging Het
Zfp867 T G 11: 59,355,850 (GRCm39) Q68P probably benign Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118,141,702 (GRCm39) missense probably benign 0.04
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R0555:Ret UTSW 6 118,155,571 (GRCm39) missense probably damaging 0.96
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5356:Ret UTSW 6 118,174,079 (GRCm39) missense possibly damaging 0.73
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6412:Ret UTSW 6 118,161,245 (GRCm39) missense probably benign 0.00
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R6884:Ret UTSW 6 118,132,362 (GRCm39) missense probably damaging 1.00
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9051:Ret UTSW 6 118,142,888 (GRCm39) nonsense probably null
R9323:Ret UTSW 6 118,158,975 (GRCm39) missense probably benign 0.00
R9661:Ret UTSW 6 118,150,437 (GRCm39) missense probably benign
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GAGGACCACCAGCTATTTGAAG -3'
(R):5'- ACTGTCTGCACATGAAGTTTG -3'

Sequencing Primer
(F):5'- GGACCACCAGCTATTTGAAGTAAAAC -3'
(R):5'- ACTGTCTGCACATGAAGTTTGAGTTC -3'
Posted On 2022-10-06