Incidental Mutation 'R9674:Cacna1i'
ID 728269
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9674 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80264629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1486 (T1486A)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably damaging
Transcript: ENSMUST00000160424
AA Change: T1486A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: T1486A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162155
AA Change: T1486A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: T1486A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 59,914,472 (GRCm39) D25V possibly damaging Het
Abca16 A G 7: 120,074,668 (GRCm39) probably null Het
Adam9 T A 8: 25,441,014 (GRCm39) T820S possibly damaging Het
Adamts6 G A 13: 104,563,448 (GRCm39) V647I probably benign Het
Afap1l2 T A 19: 56,922,195 (GRCm39) R14S probably damaging Het
Aff3 C T 1: 38,248,864 (GRCm39) V748I probably damaging Het
Aldh5a1 T C 13: 25,110,038 (GRCm39) I166V probably benign Het
Alx4 G T 2: 93,507,858 (GRCm39) L384F probably damaging Het
Ank3 T A 10: 69,824,549 (GRCm39) S1073T Het
Ankrd50 A G 3: 38,506,574 (GRCm39) C275R unknown Het
Apol11a G A 15: 77,401,347 (GRCm39) S278N possibly damaging Het
Astn2 T A 4: 65,460,963 (GRCm39) D1057V probably damaging Het
Atp11a T C 8: 12,877,525 (GRCm39) V317A probably benign Het
Cadps A G 14: 12,454,291 (GRCm38) F1076L probably damaging Het
Cct6b T C 11: 82,645,838 (GRCm39) T154A probably damaging Het
Cfap69 A G 5: 5,697,021 (GRCm39) F92L possibly damaging Het
Cyp19a1 A T 9: 54,074,141 (GRCm39) I471K possibly damaging Het
Cyp26a1 T A 19: 37,689,726 (GRCm39) M474K probably damaging Het
Cyp4a12a T C 4: 115,186,156 (GRCm39) S439P probably benign Het
Cyp4f37 T A 17: 32,846,841 (GRCm39) probably null Het
Dgki A G 6: 37,027,157 (GRCm39) Y395H probably damaging Het
Dlg1 T C 16: 31,610,580 (GRCm39) V287A probably damaging Het
Dlx2 C T 2: 71,376,496 (GRCm39) G81S possibly damaging Het
Dnah8 G T 17: 30,998,112 (GRCm39) K3448N possibly damaging Het
Dnhd1 C T 7: 105,363,429 (GRCm39) P3997L probably damaging Het
Drosha C G 15: 12,890,170 (GRCm39) D910E probably damaging Het
Dscam A G 16: 96,442,036 (GRCm39) V1597A probably benign Het
Eif1b A G 9: 120,323,265 (GRCm39) K42E possibly damaging Het
Enpp2 C A 15: 54,816,135 (GRCm39) G10W unknown Het
Exd2 A G 12: 80,536,372 (GRCm39) N334S probably benign Het
Glt6d1 T A 2: 25,684,382 (GRCm39) N208I probably benign Het
Grin2a T A 16: 9,471,265 (GRCm39) K668* probably null Het
Grm1 A G 10: 10,609,028 (GRCm39) V535A possibly damaging Het
H2ac7 A G 13: 23,758,862 (GRCm39) D73G possibly damaging Het
Hey2 A T 10: 30,710,413 (GRCm39) D113E probably benign Het
Ighm T A 12: 113,385,139 (GRCm39) I274F Het
Ighv1-58 G T 12: 115,275,847 (GRCm39) T97K probably damaging Het
Igkv6-20 T C 6: 70,312,852 (GRCm39) H107R possibly damaging Het
Il15 C T 8: 83,069,938 (GRCm39) G42D probably damaging Het
Jakmip2 T A 18: 43,704,961 (GRCm39) M347L probably benign Het
Kcnh7 T C 2: 62,595,060 (GRCm39) Y670C probably damaging Het
Ktn1 G C 14: 47,922,213 (GRCm39) C458S possibly damaging Het
Lama5 C T 2: 179,840,267 (GRCm39) probably null Het
Lce1i T C 3: 92,685,113 (GRCm39) Q21R unknown Het
Lmo7 A T 14: 102,078,340 (GRCm39) E81D probably damaging Het
Lrrc4b A T 7: 44,111,852 (GRCm39) I575F probably damaging Het
Mmrn1 C T 6: 60,948,072 (GRCm39) Q272* probably null Het
Nbea A T 3: 55,966,183 (GRCm39) D426E probably damaging Het
Neto1 G A 18: 86,491,827 (GRCm39) V243M probably damaging Het
Notch1 G A 2: 26,361,308 (GRCm39) R1061C probably damaging Het
Or5g25 T G 2: 85,478,593 (GRCm39) Q24P possibly damaging Het
Or5p67 A T 7: 107,922,271 (GRCm39) I204N probably benign Het
Osgin1 A G 8: 120,172,499 (GRCm39) D431G possibly damaging Het
Ppp4r1 A G 17: 66,140,127 (GRCm39) D675G probably damaging Het
Pramel25 T A 4: 143,520,162 (GRCm39) H135Q probably benign Het
Prkdc T A 16: 15,533,819 (GRCm39) H1552Q probably damaging Het
Rbfox1 T C 16: 7,170,885 (GRCm39) F282L probably benign Het
Ret T C 6: 118,130,830 (GRCm39) D1111G probably damaging Het
Rnf224 A T 2: 25,126,330 (GRCm39) Y8N probably benign Het
Rtl1 G T 12: 109,559,024 (GRCm39) H938Q possibly damaging Het
Sec23ip T G 7: 128,380,187 (GRCm39) D867E probably damaging Het
Sema3f A T 9: 107,566,947 (GRCm39) L194Q possibly damaging Het
Sfmbt1 C T 14: 30,495,851 (GRCm39) R45C probably damaging Het
Slc7a4 T C 16: 17,392,208 (GRCm39) I409V probably benign Het
Slco6c1 T A 1: 97,047,565 (GRCm39) D246V probably damaging Het
Smap2 C T 4: 120,826,745 (GRCm39) M426I probably benign Het
Spata31h1 C T 10: 82,120,030 (GRCm39) V4327I possibly damaging Het
Tmem184b T A 15: 79,249,524 (GRCm39) T315S probably benign Het
Trpm4 A T 7: 44,982,811 (GRCm39) D30E possibly damaging Het
Ttc7b T A 12: 100,432,553 (GRCm39) K154N probably benign Het
Vps13b T A 15: 35,607,380 (GRCm39) H1104Q probably damaging Het
Wnk4 T A 11: 101,166,874 (GRCm39) L1010Q unknown Het
Xpo6 T A 7: 125,723,700 (GRCm39) H537L probably benign Het
Xrn1 A T 9: 95,855,645 (GRCm39) Y314F probably damaging Het
Xrn1 A T 9: 95,855,647 (GRCm39) I315F possibly damaging Het
Zap70 T C 1: 36,810,150 (GRCm39) Y87H probably benign Het
Zbtb4 T C 11: 69,669,973 (GRCm39) Y899H probably damaging Het
Zcchc7 T A 4: 44,931,418 (GRCm39) H202Q possibly damaging Het
Zeb2 A G 2: 44,891,725 (GRCm39) Y276H probably damaging Het
Zfp867 T G 11: 59,355,850 (GRCm39) Q68P probably benign Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCGATGTGAAATGACTTAACACAAG -3'
(R):5'- AACAGCTCGGACATCTTGAC -3'

Sequencing Primer
(F):5'- TTAACACAAGTGAAGACATAGGAATG -3'
(R):5'- GCTCGGACATCTTGACTATCAATATC -3'
Posted On 2022-10-06