Incidental Mutation 'R9674:Dscam'
ID 728275
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9674 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 96592079-97170752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96640836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1597 (V1597A)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: V1597A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: V1597A

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,284,196 V4327I possibly damaging Het
Aadacl2 A T 3: 60,007,051 D25V possibly damaging Het
Abca16 A G 7: 120,475,445 probably null Het
Adam9 T A 8: 24,950,998 T820S possibly damaging Het
Adamts6 G A 13: 104,426,940 V647I probably benign Het
Afap1l2 T A 19: 56,933,763 R14S probably damaging Het
Aff3 C T 1: 38,209,783 V748I probably damaging Het
Aldh5a1 T C 13: 24,926,055 I166V probably benign Het
Alx4 G T 2: 93,677,513 L384F probably damaging Het
Ank3 T A 10: 69,988,719 S1073T Het
Ankrd50 A G 3: 38,452,425 C275R unknown Het
Apol11a G A 15: 77,517,147 S278N possibly damaging Het
Astn2 T A 4: 65,542,726 D1057V probably damaging Het
Atp11a T C 8: 12,827,525 V317A probably benign Het
Cacna1i A G 15: 80,380,428 T1486A probably damaging Het
Cadps A G 14: 12,454,291 F1076L probably damaging Het
Cct6b T C 11: 82,755,012 T154A probably damaging Het
Cfap69 A G 5: 5,647,021 F92L possibly damaging Het
Cyp19a1 A T 9: 54,166,857 I471K possibly damaging Het
Cyp26a1 T A 19: 37,701,278 M474K probably damaging Het
Cyp4a12a T C 4: 115,328,959 S439P probably benign Het
Cyp4f37 T A 17: 32,627,867 probably null Het
Dgki A G 6: 37,050,222 Y395H probably damaging Het
Dlg1 T C 16: 31,791,762 V287A probably damaging Het
Dlx2 C T 2: 71,546,152 G81S possibly damaging Het
Dnah8 G T 17: 30,779,138 K3448N possibly damaging Het
Dnhd1 C T 7: 105,714,222 P3997L probably damaging Het
Drosha C G 15: 12,890,084 D910E probably damaging Het
Eif1b A G 9: 120,494,199 K42E possibly damaging Het
Enpp2 C A 15: 54,952,739 G10W unknown Het
Exd2 A G 12: 80,489,598 N334S probably benign Het
Glt6d1 T A 2: 25,794,370 N208I probably benign Het
Gm13023 T A 4: 143,793,592 H135Q probably benign Het
Grin2a T A 16: 9,653,401 K668* probably null Het
Grm1 A G 10: 10,733,284 V535A possibly damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hist1h2ad A G 13: 23,574,688 D73G possibly damaging Het
Ighm T A 12: 113,421,519 I274F Het
Ighv1-58 G T 12: 115,312,227 T97K probably damaging Het
Igkv6-20 T C 6: 70,335,868 H107R possibly damaging Het
Il15 C T 8: 82,343,309 G42D probably damaging Het
Jakmip2 T A 18: 43,571,896 M347L probably benign Het
Kcnh7 T C 2: 62,764,716 Y670C probably damaging Het
Ktn1 G C 14: 47,684,756 C458S possibly damaging Het
Lama5 C T 2: 180,198,474 probably null Het
Lce1i T C 3: 92,777,806 Q21R unknown Het
Lmo7 A T 14: 101,840,904 E81D probably damaging Het
Lrrc4b A T 7: 44,462,428 I575F probably damaging Het
Mmrn1 C T 6: 60,971,088 Q272* probably null Het
Nbea A T 3: 56,058,762 D426E probably damaging Het
Neto1 G A 18: 86,473,702 V243M probably damaging Het
Notch1 G A 2: 26,471,296 R1061C probably damaging Het
Olfr1002 T G 2: 85,648,249 Q24P possibly damaging Het
Olfr492 A T 7: 108,323,064 I204N probably benign Het
Osgin1 A G 8: 119,445,760 D431G possibly damaging Het
Ppp4r1 A G 17: 65,833,132 D675G probably damaging Het
Prkdc T A 16: 15,715,955 H1552Q probably damaging Het
Rbfox1 T C 16: 7,353,021 F282L probably benign Het
Ret T C 6: 118,153,869 D1111G probably damaging Het
Rnf224 A T 2: 25,236,318 Y8N probably benign Het
Rtl1 G T 12: 109,592,590 H938Q possibly damaging Het
Sec23ip T G 7: 128,778,463 D867E probably damaging Het
Sema3f A T 9: 107,689,748 L194Q possibly damaging Het
Sfmbt1 C T 14: 30,773,894 R45C probably damaging Het
Slc7a4 T C 16: 17,574,344 I409V probably benign Het
Slco6c1 T A 1: 97,119,840 D246V probably damaging Het
Smap2 C T 4: 120,969,548 M426I probably benign Het
Tmem184b T A 15: 79,365,324 T315S probably benign Het
Trpm4 A T 7: 45,333,387 D30E possibly damaging Het
Ttc7b T A 12: 100,466,294 K154N probably benign Het
Vps13b T A 15: 35,607,234 H1104Q probably damaging Het
Wnk4 T A 11: 101,276,048 L1010Q unknown Het
Xpo6 T A 7: 126,124,528 H537L probably benign Het
Xrn1 A T 9: 95,973,592 Y314F probably damaging Het
Xrn1 A T 9: 95,973,594 I315F possibly damaging Het
Zap70 T C 1: 36,771,069 Y87H probably benign Het
Zbtb4 T C 11: 69,779,147 Y899H probably damaging Het
Zcchc7 T A 4: 44,931,418 H202Q possibly damaging Het
Zeb2 A G 2: 45,001,713 Y276H probably damaging Het
Zfp867 T G 11: 59,465,024 Q68P probably benign Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
growler UTSW 16 96820997 missense probably damaging 0.99
Twostep UTSW 16 96825782 splice site probably null
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 splice site probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 splice site probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R8108:Dscam UTSW 16 96643879 missense probably benign 0.01
R8128:Dscam UTSW 16 96801174 splice site probably null
R8770:Dscam UTSW 16 96654906 missense possibly damaging 0.50
R8876:Dscam UTSW 16 96619628 missense probably damaging 0.96
R9005:Dscam UTSW 16 96801380 missense probably damaging 1.00
R9009:Dscam UTSW 16 97038916 missense probably benign 0.10
R9168:Dscam UTSW 16 96619568 missense possibly damaging 0.82
R9176:Dscam UTSW 16 96685353 missense probably benign 0.37
R9244:Dscam UTSW 16 96685229 missense possibly damaging 0.62
R9339:Dscam UTSW 16 96716063 missense possibly damaging 0.89
R9374:Dscam UTSW 16 97056657 missense probably benign 0.19
R9385:Dscam UTSW 16 97039003 missense probably benign
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Z1177:Dscam UTSW 16 96608189 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCTCCTAGAGAACACGTC -3'
(R):5'- GGAGCTGGTCCTCTCATTTC -3'

Sequencing Primer
(F):5'- TAGAGAACACGTCCTTCCTCGG -3'
(R):5'- ACCCCTGGATCACACCGTG -3'
Posted On 2022-10-06