Incidental Mutation 'R9674:Dscam'
ID 728275
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik, Down syndrome cell adhesion molecule
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9674 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 96392040-96971952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96442036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1597 (V1597A)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: V1597A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: V1597A

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 59,914,472 (GRCm39) D25V possibly damaging Het
Abca16 A G 7: 120,074,668 (GRCm39) probably null Het
Adam9 T A 8: 25,441,014 (GRCm39) T820S possibly damaging Het
Adamts6 G A 13: 104,563,448 (GRCm39) V647I probably benign Het
Afap1l2 T A 19: 56,922,195 (GRCm39) R14S probably damaging Het
Aff3 C T 1: 38,248,864 (GRCm39) V748I probably damaging Het
Aldh5a1 T C 13: 25,110,038 (GRCm39) I166V probably benign Het
Alx4 G T 2: 93,507,858 (GRCm39) L384F probably damaging Het
Ank3 T A 10: 69,824,549 (GRCm39) S1073T Het
Ankrd50 A G 3: 38,506,574 (GRCm39) C275R unknown Het
Apol11a G A 15: 77,401,347 (GRCm39) S278N possibly damaging Het
Astn2 T A 4: 65,460,963 (GRCm39) D1057V probably damaging Het
Atp11a T C 8: 12,877,525 (GRCm39) V317A probably benign Het
Cacna1i A G 15: 80,264,629 (GRCm39) T1486A probably damaging Het
Cadps A G 14: 12,454,291 (GRCm38) F1076L probably damaging Het
Cct6b T C 11: 82,645,838 (GRCm39) T154A probably damaging Het
Cfap69 A G 5: 5,697,021 (GRCm39) F92L possibly damaging Het
Cyp19a1 A T 9: 54,074,141 (GRCm39) I471K possibly damaging Het
Cyp26a1 T A 19: 37,689,726 (GRCm39) M474K probably damaging Het
Cyp4a12a T C 4: 115,186,156 (GRCm39) S439P probably benign Het
Cyp4f37 T A 17: 32,846,841 (GRCm39) probably null Het
Dgki A G 6: 37,027,157 (GRCm39) Y395H probably damaging Het
Dlg1 T C 16: 31,610,580 (GRCm39) V287A probably damaging Het
Dlx2 C T 2: 71,376,496 (GRCm39) G81S possibly damaging Het
Dnah8 G T 17: 30,998,112 (GRCm39) K3448N possibly damaging Het
Dnhd1 C T 7: 105,363,429 (GRCm39) P3997L probably damaging Het
Drosha C G 15: 12,890,170 (GRCm39) D910E probably damaging Het
Eif1b A G 9: 120,323,265 (GRCm39) K42E possibly damaging Het
Enpp2 C A 15: 54,816,135 (GRCm39) G10W unknown Het
Exd2 A G 12: 80,536,372 (GRCm39) N334S probably benign Het
Glt6d1 T A 2: 25,684,382 (GRCm39) N208I probably benign Het
Grin2a T A 16: 9,471,265 (GRCm39) K668* probably null Het
Grm1 A G 10: 10,609,028 (GRCm39) V535A possibly damaging Het
H2ac7 A G 13: 23,758,862 (GRCm39) D73G possibly damaging Het
Hey2 A T 10: 30,710,413 (GRCm39) D113E probably benign Het
Ighm T A 12: 113,385,139 (GRCm39) I274F Het
Ighv1-58 G T 12: 115,275,847 (GRCm39) T97K probably damaging Het
Igkv6-20 T C 6: 70,312,852 (GRCm39) H107R possibly damaging Het
Il15 C T 8: 83,069,938 (GRCm39) G42D probably damaging Het
Jakmip2 T A 18: 43,704,961 (GRCm39) M347L probably benign Het
Kcnh7 T C 2: 62,595,060 (GRCm39) Y670C probably damaging Het
Ktn1 G C 14: 47,922,213 (GRCm39) C458S possibly damaging Het
Lama5 C T 2: 179,840,267 (GRCm39) probably null Het
Lce1i T C 3: 92,685,113 (GRCm39) Q21R unknown Het
Lmo7 A T 14: 102,078,340 (GRCm39) E81D probably damaging Het
Lrrc4b A T 7: 44,111,852 (GRCm39) I575F probably damaging Het
Mmrn1 C T 6: 60,948,072 (GRCm39) Q272* probably null Het
Nbea A T 3: 55,966,183 (GRCm39) D426E probably damaging Het
Neto1 G A 18: 86,491,827 (GRCm39) V243M probably damaging Het
Notch1 G A 2: 26,361,308 (GRCm39) R1061C probably damaging Het
Or5g25 T G 2: 85,478,593 (GRCm39) Q24P possibly damaging Het
Or5p67 A T 7: 107,922,271 (GRCm39) I204N probably benign Het
Osgin1 A G 8: 120,172,499 (GRCm39) D431G possibly damaging Het
Ppp4r1 A G 17: 66,140,127 (GRCm39) D675G probably damaging Het
Pramel25 T A 4: 143,520,162 (GRCm39) H135Q probably benign Het
Prkdc T A 16: 15,533,819 (GRCm39) H1552Q probably damaging Het
Rbfox1 T C 16: 7,170,885 (GRCm39) F282L probably benign Het
Ret T C 6: 118,130,830 (GRCm39) D1111G probably damaging Het
Rnf224 A T 2: 25,126,330 (GRCm39) Y8N probably benign Het
Rtl1 G T 12: 109,559,024 (GRCm39) H938Q possibly damaging Het
Sec23ip T G 7: 128,380,187 (GRCm39) D867E probably damaging Het
Sema3f A T 9: 107,566,947 (GRCm39) L194Q possibly damaging Het
Sfmbt1 C T 14: 30,495,851 (GRCm39) R45C probably damaging Het
Slc7a4 T C 16: 17,392,208 (GRCm39) I409V probably benign Het
Slco6c1 T A 1: 97,047,565 (GRCm39) D246V probably damaging Het
Smap2 C T 4: 120,826,745 (GRCm39) M426I probably benign Het
Spata31h1 C T 10: 82,120,030 (GRCm39) V4327I possibly damaging Het
Tmem184b T A 15: 79,249,524 (GRCm39) T315S probably benign Het
Trpm4 A T 7: 44,982,811 (GRCm39) D30E possibly damaging Het
Ttc7b T A 12: 100,432,553 (GRCm39) K154N probably benign Het
Vps13b T A 15: 35,607,380 (GRCm39) H1104Q probably damaging Het
Wnk4 T A 11: 101,166,874 (GRCm39) L1010Q unknown Het
Xpo6 T A 7: 125,723,700 (GRCm39) H537L probably benign Het
Xrn1 A T 9: 95,855,645 (GRCm39) Y314F probably damaging Het
Xrn1 A T 9: 95,855,647 (GRCm39) I315F possibly damaging Het
Zap70 T C 1: 36,810,150 (GRCm39) Y87H probably benign Het
Zbtb4 T C 11: 69,669,973 (GRCm39) Y899H probably damaging Het
Zcchc7 T A 4: 44,931,418 (GRCm39) H202Q possibly damaging Het
Zeb2 A G 2: 44,891,725 (GRCm39) Y276H probably damaging Het
Zfp867 T G 11: 59,355,850 (GRCm39) Q68P probably benign Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96,409,265 (GRCm39) missense possibly damaging 0.64
IGL00841:Dscam APN 16 96,621,077 (GRCm39) missense probably damaging 1.00
IGL01289:Dscam APN 16 96,445,082 (GRCm39) nonsense probably null
IGL01358:Dscam APN 16 96,411,543 (GRCm39) missense possibly damaging 0.68
IGL01431:Dscam APN 16 96,453,278 (GRCm39) critical splice donor site probably null
IGL01444:Dscam APN 16 96,474,909 (GRCm39) missense possibly damaging 0.95
IGL01767:Dscam APN 16 96,456,136 (GRCm39) missense probably damaging 1.00
IGL01866:Dscam APN 16 96,486,550 (GRCm39) missense probably benign 0.06
IGL02020:Dscam APN 16 96,517,269 (GRCm39) missense probably damaging 1.00
IGL02023:Dscam APN 16 96,602,397 (GRCm39) missense probably benign 0.06
IGL02057:Dscam APN 16 96,517,273 (GRCm39) nonsense probably null
IGL02389:Dscam APN 16 96,442,097 (GRCm39) missense probably benign 0.27
IGL02409:Dscam APN 16 96,621,088 (GRCm39) missense possibly damaging 0.46
IGL02694:Dscam APN 16 96,394,476 (GRCm39) missense probably benign 0.00
IGL02899:Dscam APN 16 96,510,447 (GRCm39) missense probably damaging 0.98
IGL02956:Dscam APN 16 96,602,472 (GRCm39) missense probably damaging 0.98
IGL03035:Dscam APN 16 96,621,170 (GRCm39) missense possibly damaging 0.94
IGL03191:Dscam APN 16 96,621,969 (GRCm39) missense probably benign 0.36
growler UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
Twostep UTSW 16 96,626,982 (GRCm39) splice site probably null
F6893:Dscam UTSW 16 96,857,660 (GRCm39) missense possibly damaging 0.78
K3955:Dscam UTSW 16 96,474,887 (GRCm39) missense probably benign 0.00
R0024:Dscam UTSW 16 96,394,585 (GRCm39) nonsense probably null
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0117:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R0211:Dscam UTSW 16 96,517,279 (GRCm39) missense possibly damaging 0.50
R0280:Dscam UTSW 16 96,840,206 (GRCm39) missense possibly damaging 0.62
R0355:Dscam UTSW 16 96,456,105 (GRCm39) missense probably benign 0.00
R0380:Dscam UTSW 16 96,857,810 (GRCm39) missense probably damaging 1.00
R0445:Dscam UTSW 16 96,573,703 (GRCm39) missense probably damaging 1.00
R0492:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0534:Dscam UTSW 16 96,453,372 (GRCm39) missense possibly damaging 0.67
R0593:Dscam UTSW 16 96,573,608 (GRCm39) missense probably benign 0.19
R0707:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0738:Dscam UTSW 16 96,620,981 (GRCm39) missense possibly damaging 0.48
R1017:Dscam UTSW 16 96,634,633 (GRCm39) missense probably damaging 1.00
R1377:Dscam UTSW 16 96,573,694 (GRCm39) missense probably damaging 1.00
R1440:Dscam UTSW 16 96,621,151 (GRCm39) missense probably damaging 1.00
R1442:Dscam UTSW 16 96,409,274 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1478:Dscam UTSW 16 96,592,110 (GRCm39) missense probably benign 0.15
R1530:Dscam UTSW 16 96,621,074 (GRCm39) missense probably damaging 1.00
R1731:Dscam UTSW 16 96,621,076 (GRCm39) missense probably damaging 1.00
R1765:Dscam UTSW 16 96,486,579 (GRCm39) missense probably benign 0.00
R1824:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign 0.00
R1933:Dscam UTSW 16 96,394,414 (GRCm39) missense probably benign 0.00
R2005:Dscam UTSW 16 96,840,120 (GRCm39) missense probably benign 0.02
R2006:Dscam UTSW 16 96,621,112 (GRCm39) missense probably damaging 1.00
R2101:Dscam UTSW 16 96,411,549 (GRCm39) missense probably benign 0.00
R2177:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 0.98
R2342:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R2851:Dscam UTSW 16 96,423,915 (GRCm39) missense possibly damaging 0.94
R2929:Dscam UTSW 16 96,486,612 (GRCm39) missense possibly damaging 0.76
R3055:Dscam UTSW 16 96,602,555 (GRCm39) missense probably damaging 1.00
R3157:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3159:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3944:Dscam UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
R4080:Dscam UTSW 16 96,484,972 (GRCm39) missense probably benign 0.01
R4285:Dscam UTSW 16 96,510,309 (GRCm39) critical splice donor site probably null
R4384:Dscam UTSW 16 96,510,416 (GRCm39) missense probably damaging 0.99
R4460:Dscam UTSW 16 96,411,519 (GRCm39) missense probably damaging 1.00
R4575:Dscam UTSW 16 96,626,823 (GRCm39) missense possibly damaging 0.82
R4594:Dscam UTSW 16 96,519,196 (GRCm39) missense possibly damaging 0.78
R4643:Dscam UTSW 16 96,486,501 (GRCm39) missense probably damaging 0.96
R4698:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R4716:Dscam UTSW 16 96,420,771 (GRCm39) missense possibly damaging 0.80
R4743:Dscam UTSW 16 96,631,256 (GRCm39) missense probably benign 0.00
R4766:Dscam UTSW 16 96,445,188 (GRCm39) missense probably benign 0.02
R4899:Dscam UTSW 16 96,485,018 (GRCm39) missense probably benign 0.01
R4987:Dscam UTSW 16 96,498,721 (GRCm39) missense probably benign 0.00
R4990:Dscam UTSW 16 96,626,715 (GRCm39) missense probably benign 0.12
R5123:Dscam UTSW 16 96,573,637 (GRCm39) missense probably damaging 1.00
R5130:Dscam UTSW 16 96,620,979 (GRCm39) missense probably benign 0.00
R5328:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R5666:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5670:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5678:Dscam UTSW 16 96,592,100 (GRCm39) missense probably benign 0.16
R5827:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R5907:Dscam UTSW 16 96,622,120 (GRCm39) missense probably damaging 0.97
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6103:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign
R6240:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R6257:Dscam UTSW 16 96,474,914 (GRCm39) missense possibly damaging 0.94
R6361:Dscam UTSW 16 96,424,011 (GRCm39) missense probably benign 0.08
R6405:Dscam UTSW 16 96,479,625 (GRCm39) missense probably damaging 1.00
R6444:Dscam UTSW 16 96,420,844 (GRCm39) missense probably damaging 1.00
R6560:Dscam UTSW 16 96,626,935 (GRCm39) missense probably benign 0.00
R6598:Dscam UTSW 16 96,620,984 (GRCm39) missense probably damaging 1.00
R6622:Dscam UTSW 16 96,446,273 (GRCm39) missense probably benign 0.06
R6792:Dscam UTSW 16 96,449,437 (GRCm39) missense probably damaging 1.00
R6792:Dscam UTSW 16 96,394,455 (GRCm39) missense probably damaging 0.96
R6827:Dscam UTSW 16 96,840,191 (GRCm39) missense probably damaging 1.00
R6868:Dscam UTSW 16 96,631,140 (GRCm39) missense probably damaging 1.00
R6898:Dscam UTSW 16 96,631,100 (GRCm39) missense probably benign 0.02
R6903:Dscam UTSW 16 96,621,988 (GRCm39) missense probably damaging 1.00
R7051:Dscam UTSW 16 96,620,986 (GRCm39) missense probably benign 0.01
R7146:Dscam UTSW 16 96,631,117 (GRCm39) nonsense probably null
R7180:Dscam UTSW 16 96,626,764 (GRCm39) missense probably damaging 0.97
R7209:Dscam UTSW 16 96,451,544 (GRCm39) splice site probably null
R7247:Dscam UTSW 16 96,622,008 (GRCm39) missense probably damaging 0.99
R7269:Dscam UTSW 16 96,479,601 (GRCm39) missense probably benign 0.00
R7301:Dscam UTSW 16 96,857,732 (GRCm39) missense probably benign 0.01
R7328:Dscam UTSW 16 96,446,235 (GRCm39) nonsense probably null
R7368:Dscam UTSW 16 96,445,131 (GRCm39) missense probably benign 0.00
R7425:Dscam UTSW 16 96,430,598 (GRCm39) missense probably damaging 1.00
R7474:Dscam UTSW 16 96,621,089 (GRCm39) missense possibly damaging 0.88
R7536:Dscam UTSW 16 96,442,226 (GRCm39) splice site probably null
R7624:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R7766:Dscam UTSW 16 96,592,101 (GRCm39) missense probably benign 0.31
R7817:Dscam UTSW 16 96,442,064 (GRCm39) missense probably benign
R7843:Dscam UTSW 16 96,626,830 (GRCm39) missense probably damaging 0.99
R7911:Dscam UTSW 16 96,445,122 (GRCm39) missense probably benign 0.01
R8108:Dscam UTSW 16 96,445,079 (GRCm39) missense probably benign 0.01
R8128:Dscam UTSW 16 96,602,374 (GRCm39) splice site probably null
R8770:Dscam UTSW 16 96,456,106 (GRCm39) missense possibly damaging 0.50
R8876:Dscam UTSW 16 96,420,828 (GRCm39) missense probably damaging 0.96
R9005:Dscam UTSW 16 96,602,580 (GRCm39) missense probably damaging 1.00
R9009:Dscam UTSW 16 96,840,116 (GRCm39) missense probably benign 0.10
R9168:Dscam UTSW 16 96,420,768 (GRCm39) missense possibly damaging 0.82
R9176:Dscam UTSW 16 96,486,553 (GRCm39) missense probably benign 0.37
R9244:Dscam UTSW 16 96,486,429 (GRCm39) missense possibly damaging 0.62
R9339:Dscam UTSW 16 96,517,263 (GRCm39) missense possibly damaging 0.89
R9374:Dscam UTSW 16 96,857,857 (GRCm39) missense probably benign 0.19
R9385:Dscam UTSW 16 96,840,203 (GRCm39) missense probably benign
X0025:Dscam UTSW 16 96,510,361 (GRCm39) missense probably damaging 1.00
Z1088:Dscam UTSW 16 96,573,761 (GRCm39) missense probably benign 0.01
Z1177:Dscam UTSW 16 96,409,389 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCTCCTAGAGAACACGTC -3'
(R):5'- GGAGCTGGTCCTCTCATTTC -3'

Sequencing Primer
(F):5'- TAGAGAACACGTCCTTCCTCGG -3'
(R):5'- ACCCCTGGATCACACCGTG -3'
Posted On 2022-10-06