Incidental Mutation 'R9674:Jakmip2'
ID 728279
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock # R9674 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43571896 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 347 (M347L)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably benign
Transcript: ENSMUST00000082254
AA Change: M347L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: M347L

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,284,196 V4327I possibly damaging Het
Aadacl2 A T 3: 60,007,051 D25V possibly damaging Het
Abca16 A G 7: 120,475,445 probably null Het
Adam9 T A 8: 24,950,998 T820S possibly damaging Het
Adamts6 G A 13: 104,426,940 V647I probably benign Het
Afap1l2 T A 19: 56,933,763 R14S probably damaging Het
Aff3 C T 1: 38,209,783 V748I probably damaging Het
Aldh5a1 T C 13: 24,926,055 I166V probably benign Het
Alx4 G T 2: 93,677,513 L384F probably damaging Het
Ank3 T A 10: 69,988,719 S1073T Het
Ankrd50 A G 3: 38,452,425 C275R unknown Het
Apol11a G A 15: 77,517,147 S278N possibly damaging Het
Astn2 T A 4: 65,542,726 D1057V probably damaging Het
Atp11a T C 8: 12,827,525 V317A probably benign Het
Cacna1i A G 15: 80,380,428 T1486A probably damaging Het
Cadps A G 14: 12,454,291 F1076L probably damaging Het
Cct6b T C 11: 82,755,012 T154A probably damaging Het
Cfap69 A G 5: 5,647,021 F92L possibly damaging Het
Cyp19a1 A T 9: 54,166,857 I471K possibly damaging Het
Cyp26a1 T A 19: 37,701,278 M474K probably damaging Het
Cyp4a12a T C 4: 115,328,959 S439P probably benign Het
Cyp4f37 T A 17: 32,627,867 probably null Het
Dgki A G 6: 37,050,222 Y395H probably damaging Het
Dlg1 T C 16: 31,791,762 V287A probably damaging Het
Dlx2 C T 2: 71,546,152 G81S possibly damaging Het
Dnah8 G T 17: 30,779,138 K3448N possibly damaging Het
Dnhd1 C T 7: 105,714,222 P3997L probably damaging Het
Drosha C G 15: 12,890,084 D910E probably damaging Het
Dscam A G 16: 96,640,836 V1597A probably benign Het
Eif1b A G 9: 120,494,199 K42E possibly damaging Het
Enpp2 C A 15: 54,952,739 G10W unknown Het
Exd2 A G 12: 80,489,598 N334S probably benign Het
Glt6d1 T A 2: 25,794,370 N208I probably benign Het
Gm13023 T A 4: 143,793,592 H135Q probably benign Het
Grin2a T A 16: 9,653,401 K668* probably null Het
Grm1 A G 10: 10,733,284 V535A possibly damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hist1h2ad A G 13: 23,574,688 D73G possibly damaging Het
Ighm T A 12: 113,421,519 I274F Het
Ighv1-58 G T 12: 115,312,227 T97K probably damaging Het
Igkv6-20 T C 6: 70,335,868 H107R possibly damaging Het
Il15 C T 8: 82,343,309 G42D probably damaging Het
Kcnh7 T C 2: 62,764,716 Y670C probably damaging Het
Ktn1 G C 14: 47,684,756 C458S possibly damaging Het
Lama5 C T 2: 180,198,474 probably null Het
Lce1i T C 3: 92,777,806 Q21R unknown Het
Lmo7 A T 14: 101,840,904 E81D probably damaging Het
Lrrc4b A T 7: 44,462,428 I575F probably damaging Het
Mmrn1 C T 6: 60,971,088 Q272* probably null Het
Nbea A T 3: 56,058,762 D426E probably damaging Het
Neto1 G A 18: 86,473,702 V243M probably damaging Het
Notch1 G A 2: 26,471,296 R1061C probably damaging Het
Olfr1002 T G 2: 85,648,249 Q24P possibly damaging Het
Olfr492 A T 7: 108,323,064 I204N probably benign Het
Osgin1 A G 8: 119,445,760 D431G possibly damaging Het
Ppp4r1 A G 17: 65,833,132 D675G probably damaging Het
Prkdc T A 16: 15,715,955 H1552Q probably damaging Het
Rbfox1 T C 16: 7,353,021 F282L probably benign Het
Ret T C 6: 118,153,869 D1111G probably damaging Het
Rnf224 A T 2: 25,236,318 Y8N probably benign Het
Rtl1 G T 12: 109,592,590 H938Q possibly damaging Het
Sec23ip T G 7: 128,778,463 D867E probably damaging Het
Sema3f A T 9: 107,689,748 L194Q possibly damaging Het
Sfmbt1 C T 14: 30,773,894 R45C probably damaging Het
Slc7a4 T C 16: 17,574,344 I409V probably benign Het
Slco6c1 T A 1: 97,119,840 D246V probably damaging Het
Smap2 C T 4: 120,969,548 M426I probably benign Het
Tmem184b T A 15: 79,365,324 T315S probably benign Het
Trpm4 A T 7: 45,333,387 D30E possibly damaging Het
Ttc7b T A 12: 100,466,294 K154N probably benign Het
Vps13b T A 15: 35,607,234 H1104Q probably damaging Het
Wnk4 T A 11: 101,276,048 L1010Q unknown Het
Xpo6 T A 7: 126,124,528 H537L probably benign Het
Xrn1 A T 9: 95,973,592 Y314F probably damaging Het
Xrn1 A T 9: 95,973,594 I315F possibly damaging Het
Zap70 T C 1: 36,771,069 Y87H probably benign Het
Zbtb4 T C 11: 69,779,147 Y899H probably damaging Het
Zcchc7 T A 4: 44,931,418 H202Q possibly damaging Het
Zeb2 A G 2: 45,001,713 Y276H probably damaging Het
Zfp867 T G 11: 59,465,024 Q68P probably benign Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCAAGGGAAAATCCAAGTGGTTG -3'
(R):5'- GGGCTGTTTTCCTTGTTCAC -3'

Sequencing Primer
(F):5'- AGTGGTTGGTACACACACAC -3'
(R):5'- GGCTGTTTTCCTTGTTCACACCTG -3'
Posted On 2022-10-06