Mutagenetix > Incidental Mutation

Incidental Mutation 'R9676:2700049A03Rik'

728354

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3, Ta3

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9676 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71183622-71290077 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71207905 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 534 (S534P)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

AlphaFold

E9PV87

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045907
AA Change: S534P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: S534P

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149564
AA Change: S534P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: S534P

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	T	5: 8,714,548 (GRCm39)	K23I	possibly damaging	Het
Arhgef1	G	A	7: 24,625,501 (GRCm39)	G961E	probably benign	Het
Cand2	A	G	6: 115,769,122 (GRCm39)	D644G	probably benign	Het
Ciart	A	G	3: 95,786,214 (GRCm39)	V287A	probably benign	Het
Cldn10	G	T	14: 119,025,677 (GRCm39)	V37L	probably damaging	Het
Clec16a	C	A	16: 10,559,823 (GRCm39)	T1032K	probably benign	Het
Crhbp	A	T	13: 95,578,711 (GRCm39)	Y144N	probably damaging	Het
Ddn	A	T	15: 98,703,252 (GRCm39)	I680N	possibly damaging	Het
Dock4	TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC	TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC	12: 40,894,379 (GRCm39)		probably benign	Het
Dock4	CCGGTG	CCGGTGACGGTG	12: 40,894,401 (GRCm39)		probably benign	Het
Dock4	GGTGCC	GGTGCCTGTGCC	12: 40,894,397 (GRCm39)		probably benign	Het
Dock4	TGCCGG	TGCCGGGGCCGG	12: 40,894,387 (GRCm39)		probably benign	Het
Dock7	T	C	4: 98,904,922 (GRCm39)	Y651C	probably damaging	Het
Ecel1	A	T	1: 87,079,743 (GRCm39)	F457I	probably damaging	Het
Eif4h	G	A	5: 134,668,242 (GRCm39)		probably benign	Het
Focad	T	C	4: 88,273,682 (GRCm39)	V1073A	unknown	Het
Gm9195	G	A	14: 72,709,667 (GRCm39)	P482S	unknown	Het
Ifi206	G	A	1: 173,308,718 (GRCm39)	T426I		Het
Irag2	T	G	6: 145,120,338 (GRCm39)	W518G	probably damaging	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,079,903 (GRCm39)		probably benign	Het
Lpar3	T	C	3: 145,990,434 (GRCm39)	C251R	probably damaging	Het
Lrrn4cl	A	G	19: 8,829,496 (GRCm39)	D158G	probably benign	Het
Myo5b	T	A	18: 74,892,231 (GRCm39)	N1632K	probably benign	Het
Neb	T	C	2: 52,060,558 (GRCm39)	K6275E	possibly damaging	Het
Niban2	G	A	2: 32,802,581 (GRCm39)	V191I	probably benign	Het
Or1j10	A	G	2: 36,266,848 (GRCm39)	E20G	probably benign	Het
Or2t47	T	A	11: 58,442,253 (GRCm39)	M271L	probably benign	Het
Or4a70	A	T	2: 89,323,780 (GRCm39)	M292K	probably damaging	Het
Phactr3	G	T	2: 177,925,837 (GRCm39)	E371*	probably null	Het
Pigt	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	2: 164,341,589 (GRCm39)		probably null	Het
Plagl1	T	C	10: 13,003,955 (GRCm39)	Y408H	unknown	Het
Pole	A	G	5: 110,443,431 (GRCm39)	Q385R	probably benign	Het
Rps15a	A	T	7: 117,714,361 (GRCm39)	V35D	probably benign	Het
Sh3rf2	C	T	18: 42,282,860 (GRCm39)	P505S	probably benign	Het
Srrm4	T	C	5: 116,584,781 (GRCm39)		probably benign	Het
Tenm4	G	T	7: 96,544,638 (GRCm39)	R2255L	probably damaging	Het
Ttc29	A	G	8: 79,060,384 (GRCm39)	T435A	probably benign	Het
Vmn2r79	T	C	7: 86,686,452 (GRCm39)	V611A	probably damaging	Het
Zfp568	T	C	7: 29,721,823 (GRCm39)	V256A	probably benign	Het
Zfyve26	T	C	12: 79,330,959 (GRCm39)	K420R	probably benign	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71,213,893 (GRCm39)	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71,241,242 (GRCm39)	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71,211,152 (GRCm39)	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71,213,957 (GRCm39)	missense	probably benign	0.00
IGL01835:2700049A03Rik	APN	12	71,213,955 (GRCm39)	nonsense	probably null
IGL02122:2700049A03Rik	APN	12	71,217,299 (GRCm39)	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71,195,034 (GRCm39)	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71,201,630 (GRCm39)	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71,240,147 (GRCm39)	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71,187,657 (GRCm39)	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71,205,599 (GRCm39)	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71,184,683 (GRCm39)	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71,207,160 (GRCm39)	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71,217,440 (GRCm39)	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71,224,692 (GRCm39)	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71,213,924 (GRCm39)	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71,195,194 (GRCm39)	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71,184,804 (GRCm39)	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71,240,084 (GRCm39)	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71,211,162 (GRCm39)	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71,224,642 (GRCm39)	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71,205,657 (GRCm39)	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71,266,082 (GRCm39)	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71,262,918 (GRCm39)	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71,217,361 (GRCm39)	splice site	probably null
R1599:2700049A03Rik	UTSW	12	71,197,033 (GRCm39)	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71,265,995 (GRCm39)	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71,197,018 (GRCm39)	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71,207,186 (GRCm39)	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71,235,393 (GRCm39)	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2337:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2512:2700049A03Rik	UTSW	12	71,219,945 (GRCm39)	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71,201,530 (GRCm39)	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3236:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71,195,037 (GRCm39)	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4735:2700049A03Rik	UTSW	12	71,262,897 (GRCm39)	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71,236,216 (GRCm39)	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4852:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4855:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71,236,420 (GRCm39)	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71,289,799 (GRCm39)	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,240,123 (GRCm39)	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71,235,565 (GRCm39)	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71,289,801 (GRCm39)	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5502:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5725:2700049A03Rik	UTSW	12	71,240,093 (GRCm39)	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71,203,893 (GRCm39)	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71,231,304 (GRCm39)	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71,234,200 (GRCm39)	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71,217,410 (GRCm39)	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71,211,318 (GRCm39)	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71,263,004 (GRCm39)	splice site	probably null
R7168:2700049A03Rik	UTSW	12	71,262,831 (GRCm39)	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71,265,963 (GRCm39)	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71,187,680 (GRCm39)	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71,236,348 (GRCm39)	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71,197,179 (GRCm39)	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7922:2700049A03Rik	UTSW	12	71,211,180 (GRCm39)	missense	possibly damaging	0.83
R7966:2700049A03Rik	UTSW	12	71,219,903 (GRCm39)	missense	probably benign	0.00
R8082:2700049A03Rik	UTSW	12	71,188,895 (GRCm39)	critical splice donor site	probably null
R8311:2700049A03Rik	UTSW	12	71,184,815 (GRCm39)	unclassified	probably benign
R8408:2700049A03Rik	UTSW	12	71,236,356 (GRCm39)	missense	possibly damaging	0.71
R8852:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R8860:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R9039:2700049A03Rik	UTSW	12	71,213,849 (GRCm39)	missense	possibly damaging	0.51
R9281:2700049A03Rik	UTSW	12	71,205,687 (GRCm39)	missense	possibly damaging	0.51
R9308:2700049A03Rik	UTSW	12	71,231,233 (GRCm39)	missense	probably benign	0.23
R9385:2700049A03Rik	UTSW	12	71,207,966 (GRCm39)	missense	possibly damaging	0.52
R9412:2700049A03Rik	UTSW	12	71,235,457 (GRCm39)	missense	possibly damaging	0.71
R9643:2700049A03Rik	UTSW	12	71,211,189 (GRCm39)	missense	possibly damaging	0.92
R9776:2700049A03Rik	UTSW	12	71,235,448 (GRCm39)	missense	possibly damaging	0.71
R9789:2700049A03Rik	UTSW	12	71,231,357 (GRCm39)	missense	probably benign
Z1177:2700049A03Rik	UTSW	12	71,211,258 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTGCAGTTTCCCATTTCG -3'
(R):5'- GCTGGCTTAAAACACCTTTGC -3'

Sequencing Primer
(F):5'- CCTCCAGTTCTTCACAGACAC -3'
(R):5'- ATGGTGGCTCACAACCATCTG -3'

Posted On

2022-10-06