Incidental Mutation 'R9679:Dock5'
ID 728432
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock # R9679 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67781001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1242 (R1242W)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably damaging
Transcript: ENSMUST00000039135
AA Change: R1242W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: R1242W

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a T A 12: 113,545,922 N638K probably benign Het
Arid5a A G 1: 36,318,567 K188E possibly damaging Het
Atp11a T C 8: 12,859,388 I1082T possibly damaging Het
Bdp1 T A 13: 100,043,777 I1845F probably damaging Het
Ccdc87 A C 19: 4,841,271 E597A probably benign Het
Cfap53 A T 18: 74,359,585 Q460L possibly damaging Het
Clcn1 G A 6: 42,286,819 S18N probably damaging Het
Cntnap3 C A 13: 64,751,748 C977F probably damaging Het
Colec11 C A 12: 28,594,830 V222L probably benign Het
Dchs2 G T 3: 83,354,390 S2655I probably damaging Het
Dnah8 A G 17: 30,818,141 T4227A probably benign Het
Ebf3 T A 7: 137,231,235 N237I possibly damaging Het
F2rl3 T A 8: 72,763,033 L296Q probably damaging Het
Fbn2 A G 18: 58,068,361 I1328T probably damaging Het
Fes T C 7: 80,383,302 E258G probably benign Het
Gins4 G A 8: 23,227,116 A212V probably damaging Het
Gm9573 A G 17: 35,619,599 S1232P unknown Het
Il15 T C 8: 82,344,465 Y7C probably benign Het
Il9r T G 11: 32,190,853 H395P probably benign Het
Jade1 T C 3: 41,613,134 S546P probably damaging Het
Krt72 C T 15: 101,776,717 G469D probably damaging Het
Limd1 T A 9: 123,479,392 M52K probably damaging Het
Mamdc2 T C 19: 23,374,016 N182S probably benign Het
Mrpl14 A G 17: 45,698,314 N113S probably damaging Het
Ms4a14 A G 19: 11,302,684 S837P possibly damaging Het
Myh11 A T 16: 14,277,572 Y109N Het
Nfrkb C T 9: 31,410,089 T694M probably benign Het
Nlrp4b T G 7: 10,715,257 S462R probably benign Het
Olfr1009 T A 2: 85,722,138 H244Q probably damaging Het
Olfr1281 A G 2: 111,329,000 T194A probably benign Het
Olfr187 A G 16: 59,036,158 L193P possibly damaging Het
Olfr589 T C 7: 103,155,445 I101V probably benign Het
Olfr809 A G 10: 129,776,013 Y33C probably damaging Het
Rasip1 T C 7: 45,627,903 V45A possibly damaging Het
Rgs22 A G 15: 36,087,441 S568P probably benign Het
Sephs1 T A 2: 4,893,294 L172Q probably damaging Het
Skiv2l2 A G 13: 112,895,521 S586P probably damaging Het
Slc16a3 T C 11: 120,956,397 L137P probably damaging Het
Slc22a4 T C 11: 53,990,773 Y373C probably damaging Het
Snx1 T C 9: 66,090,720 D410G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Stam2 G T 2: 52,716,570 A101D probably damaging Het
Surf4 A G 2: 26,924,352 F179S probably benign Het
Taf8 C T 17: 47,490,176 R294Q unknown Het
Tnr A G 1: 159,892,038 T962A probably benign Het
Tpx2 T A 2: 152,869,698 I51K possibly damaging Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Usp34 T A 11: 23,444,369 Y2305N Het
Vil1 C A 1: 74,430,674 Q740K probably benign Het
Vmn1r236 T C 17: 21,287,024 F135L possibly damaging Het
Vmn1r57 A C 7: 5,221,231 I252L probably benign Het
Vmn2r77 T C 7: 86,811,533 L689P probably benign Het
Wdr1 A G 5: 38,527,873 L585P probably damaging Het
Wdr6 T C 9: 108,573,159 I1057V probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAACTGTATTTGTCTGGGGCTC -3'
(R):5'- TGGCTCTTTGGAGAAGTGAC -3'

Sequencing Primer
(F):5'- CTGTTTAGAGAGCTCACCCC -3'
(R):5'- CTGTAGATCCAGCTCCAGATGAGTG -3'
Posted On 2022-10-06