Incidental Mutation 'R9680:Fsip2'
ID 728456
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Name fibrous sheath-interacting protein 2
Synonyms OTTMUSG00000013335
MMRRC Submission
Accession Numbers

Genbank: XM_913669; MGI: 2664111

Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R9680 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 82943634-83008937 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 82988928 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 5002 (S5002A)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000132967
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143764
AA Change: S5002A

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: S5002A

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,202,301 N1077S possibly damaging Het
Adam25 T A 8: 40,755,202 Y502N probably damaging Het
Adam6a T A 12: 113,545,864 L619* probably null Het
Akap9 A T 5: 3,961,587 R763S probably benign Het
Akt3 G A 1: 177,131,073 P24S probably damaging Het
Ano2 A T 6: 125,880,419 probably null Het
B4galnt4 G A 7: 141,068,044 R491Q possibly damaging Het
Bahcc1 A G 11: 120,272,460 D528G possibly damaging Het
Camk1g G T 1: 193,348,175 Q409K probably benign Het
Cdh3 T A 8: 106,547,764 N638K probably benign Het
Cgnl1 T A 9: 71,655,350 E882D possibly damaging Het
Cpxm2 C T 7: 132,059,922 E379K probably damaging Het
Cyp3a16 A G 5: 145,452,880 L225P probably damaging Het
Dchs1 T C 7: 105,762,418 E1497G probably damaging Het
Denr T A 5: 123,927,054 S157T possibly damaging Het
Disp3 A G 4: 148,271,644 I253T probably damaging Het
Dlgap2 C T 8: 14,846,653 T1043M probably damaging Het
Epb41l5 T C 1: 119,608,074 T355A probably damaging Het
Etv6 G A 6: 134,036,099 probably benign Het
Fbn1 T C 2: 125,468,564 I141V probably benign Het
Gbf1 T G 19: 46,283,398 V1576G probably damaging Het
Gm853 A G 4: 130,221,734 V7A probably benign Het
Gmfg T A 7: 28,441,308 probably null Het
Gsdmc4 T C 15: 63,902,857 E25G possibly damaging Het
Igkv6-23 A T 6: 70,260,900 L12M possibly damaging Het
Kank1 G A 19: 25,410,774 V604M probably damaging Het
Kctd1 A G 18: 15,007,765 V40A probably damaging Het
Krt222 T C 11: 99,236,239 K185R possibly damaging Het
Lipm T C 19: 34,112,094 F151L probably damaging Het
Lrrc2 A T 9: 110,962,642 N154I probably damaging Het
Map1a T A 2: 121,302,384 M1227K probably damaging Het
Med1 T C 11: 98,180,288 T78A probably damaging Het
Mrm1 A G 11: 84,819,318 S19P possibly damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nap1l1 A G 10: 111,494,796 Y354C probably damaging Het
Npr1 A G 3: 90,461,141 V474A probably benign Het
Nyap1 A T 5: 137,735,578 S398T probably damaging Het
Obox7 C T 7: 14,664,142 Q36* probably null Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr767 A T 10: 129,079,489 I158N probably benign Het
P3h1 T A 4: 119,233,231 L92H probably benign Het
Pappa2 T C 1: 158,782,248 T1548A possibly damaging Het
Pnisr A G 4: 21,873,586 E443G probably damaging Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Prom1 A T 5: 44,032,942 probably null Het
Rbm27 A T 18: 42,322,121 Q646H probably damaging Het
Scamp3 C T 3: 89,180,254 R134* probably null Het
Scrt2 T C 2: 152,082,098 C17R probably benign Het
Setbp1 A G 18: 78,859,283 S390P probably benign Het
Shank2 A T 7: 144,411,100 D815V probably damaging Het
Sirt7 G A 11: 120,620,470 T285M Het
Sis T G 3: 72,956,288 S206R probably benign Het
Slc24a4 T G 12: 102,227,075 D206E possibly damaging Het
Slc26a4 C A 12: 31,535,293 G501C probably damaging Het
Sptb T C 12: 76,630,715 N115S probably damaging Het
Srprb T C 9: 103,197,608 T112A possibly damaging Het
Tbk1 G T 10: 121,553,936 A537E probably benign Het
Tbx19 T A 1: 165,142,498 H274L probably damaging Het
Tmem130 A G 5: 144,737,423 S394P probably damaging Het
Tmem40 A G 6: 115,741,556 S104P possibly damaging Het
Tmprss2 T A 16: 97,578,626 Q158L probably damaging Het
Tnip1 A T 11: 54,938,050 V97D possibly damaging Het
Tpr T A 1: 150,439,136 S1985T probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trio G T 15: 27,744,072 N2591K possibly damaging Het
Ushbp1 A T 8: 71,385,929 C618S possibly damaging Het
Usp34 A G 11: 23,367,385 S834G possibly damaging Het
Vmn2r103 C A 17: 19,799,263 C536* probably null Het
Vmn2r124 T A 17: 18,073,496 V615D probably damaging Het
Zbtb38 G A 9: 96,688,344 T229I probably benign Het
Zfhx4 T A 3: 5,400,596 V1963E probably damaging Het
Zfp142 G A 1: 74,571,774 T954M probably benign Het
Zgrf1 A G 3: 127,615,567 Y1730C probably benign Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82990386 missense probably benign 0.18
IGL00557:Fsip2 APN 2 82991313 missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82999819 missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82992982 missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82977519 missense probably benign
IGL01554:Fsip2 APN 2 82977278 missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82991086 missense probably benign 0.33
IGL01809:Fsip2 APN 2 82978347 missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82982639 missense probably benign 0.18
IGL01830:Fsip2 APN 2 82984929 missense probably benign
IGL01918:Fsip2 APN 2 82992138 missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82994005 missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82993867 missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82991860 missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82978721 missense probably benign
IGL02155:Fsip2 APN 2 82998352 missense probably benign
IGL02219:Fsip2 APN 2 82977830 missense probably benign 0.07
IGL02248:Fsip2 APN 2 82982772 missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82978793 missense probably benign
IGL02478:Fsip2 APN 2 82984392 missense probably benign 0.00
IGL02504:Fsip2 APN 2 82978855 missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82992003 missense probably benign 0.32
IGL02625:Fsip2 APN 2 82949492 missense probably benign 0.00
IGL02665:Fsip2 APN 2 82993063 missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82998318 missense probably benign 0.06
IGL02676:Fsip2 APN 2 82982157 missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82951026 splice site probably benign
IGL02805:Fsip2 APN 2 82993495 missense probably benign 0.01
IGL02943:Fsip2 APN 2 82992357 missense probably benign 0.32
IGL02965:Fsip2 APN 2 82983054 missense probably benign 0.33
IGL03001:Fsip2 APN 2 82990624 intron probably benign
IGL03076:Fsip2 APN 2 82982138 missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82978076 missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82977393 missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82990470 missense probably benign
bubblegum UTSW 2 82992840 missense probably benign 0.16
Dao UTSW 2 82993150 missense probably damaging 0.97
engulf UTSW 2 82984776 missense probably damaging 0.98
envelope UTSW 2 82980741 missense probably benign 0.07
gladius UTSW 2 82981949 missense possibly damaging 0.68
glove UTSW 2 82978394 missense possibly damaging 0.85
Katana UTSW 2 82989516 missense probably benign 0.07
scarf UTSW 2 82986891 missense probably benign
Sock UTSW 2 82998180 missense probably benign 0.00
swaddle UTSW 2 82983428 missense possibly damaging 0.93
wrap UTSW 2 82986820 missense probably benign 0.04
Wrapper UTSW 2 82990086 missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82988412 missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82984362 critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82984365 critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82990852 missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82999857 splice site probably benign
R0054:Fsip2 UTSW 2 82976608 missense probably damaging 0.96
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82984925 missense probably benign 0.28
R0131:Fsip2 UTSW 2 82991121 missense probably benign
R0149:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82980807 missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82985177 missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82985896 missense probably benign 0.33
R0358:Fsip2 UTSW 2 82983333 missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82984564 missense probably benign 0.33
R0394:Fsip2 UTSW 2 82991075 missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82977785 missense probably benign 0.33
R0595:Fsip2 UTSW 2 82946952 missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82993795 missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82977533 missense probably benign 0.15
R0619:Fsip2 UTSW 2 82944140 missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82988958 missense probably benign 0.06
R0644:Fsip2 UTSW 2 82976897 missense probably benign 0.02
R0661:Fsip2 UTSW 2 82986169 missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82991359 missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82982339 missense probably benign 0.18
R0881:Fsip2 UTSW 2 82986273 missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82985484 missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0974:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0976:Fsip2 UTSW 2 82998031 missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82989436 nonsense probably null
R1026:Fsip2 UTSW 2 82988461 missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82975034 missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82991500 missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82975226 missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82975017 missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82981011 missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82989763 missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82989408 missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82989745 missense probably benign 0.38
R1413:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82998063 missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82987195 missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82979811 missense probably benign
R1520:Fsip2 UTSW 2 82980714 missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82981587 missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82986282 missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R1646:Fsip2 UTSW 2 82978517 missense probably benign 0.07
R1678:Fsip2 UTSW 2 82986345 missense probably benign
R1700:Fsip2 UTSW 2 82991737 missense probably benign 0.33
R1717:Fsip2 UTSW 2 82974945 missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82989912 missense probably benign 0.32
R1760:Fsip2 UTSW 2 82984896 missense probably benign 0.07
R1760:Fsip2 UTSW 2 82987711 missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82999841 missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82977562 missense probably benign 0.00
R1850:Fsip2 UTSW 2 82984589 missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82993257 missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1905:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1921:Fsip2 UTSW 2 82980783 nonsense probably null
R1921:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1931:Fsip2 UTSW 2 82986733 missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82980558 missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82991550 missense probably benign
R1965:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82979831 missense probably benign
R1988:Fsip2 UTSW 2 82976517 missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82989444 missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R2037:Fsip2 UTSW 2 82978512 missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82976355 missense probably damaging 0.98
R2072:Fsip2 UTSW 2 83008815 missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82988579 missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82990271 missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82977479 missense probably benign 0.02
R2256:Fsip2 UTSW 2 82962751 missense probably benign 0.07
R2315:Fsip2 UTSW 2 82975093 missense probably benign
R2344:Fsip2 UTSW 2 82989913 missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82976249 missense probably benign 0.29
R2403:Fsip2 UTSW 2 82980720 missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82985341 missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82979610 missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82986438 missense probably benign
R2511:Fsip2 UTSW 2 82951657 missense probably damaging 1.00
R2511:Fsip2 UTSW 2 82986438 missense probably benign
R2512:Fsip2 UTSW 2 82978167 missense probably benign 0.04
R2568:Fsip2 UTSW 2 82990431 missense probably benign 0.14
R2656:Fsip2 UTSW 2 82979045 missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82991524 missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82986510 missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82992010 missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82986727 missense probably benign 0.00
R3605:Fsip2 UTSW 2 82984909 missense probably benign 0.28
R3620:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3621:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3726:Fsip2 UTSW 2 82988967 missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82978217 missense probably benign 0.26
R3789:Fsip2 UTSW 2 82982714 missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82950946 missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82989606 missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82986415 missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82984776 missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82958662 missense probably benign 0.08
R4014:Fsip2 UTSW 2 82983518 missense probably benign
R4042:Fsip2 UTSW 2 82983552 missense probably benign 0.02
R4075:Fsip2 UTSW 2 82982901 missense probably benign 0.26
R4154:Fsip2 UTSW 2 82987069 missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R4332:Fsip2 UTSW 2 82977857 missense probably benign 0.00
R4440:Fsip2 UTSW 2 82991206 missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82951665 missense probably benign
R4549:Fsip2 UTSW 2 82989628 missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82984953 missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82986166 missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82978673 missense probably benign 0.33
R4618:Fsip2 UTSW 2 82987759 missense probably benign
R4700:Fsip2 UTSW 2 82987029 missense probably benign 0.32
R4716:Fsip2 UTSW 2 82974859 missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82975353 missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82989285 missense probably benign 0.06
R4791:Fsip2 UTSW 2 82982108 missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82987700 nonsense probably null
R4819:Fsip2 UTSW 2 82988442 missense probably benign 0.06
R4832:Fsip2 UTSW 2 82990171 missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82949395 missense probably benign 0.01
R4840:Fsip2 UTSW 2 82985471 missense probably benign 0.26
R4865:Fsip2 UTSW 2 82990951 missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82974858 missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82988094 missense probably benign 0.02
R4911:Fsip2 UTSW 2 82981493 missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82993770 missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82985040 missense probably benign 0.18
R4950:Fsip2 UTSW 2 82946932 missense probably damaging 0.97
R4950:Fsip2 UTSW 2 82977414 missense probably benign 0.03
R4959:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4971:Fsip2 UTSW 2 82985878 missense probably benign 0.38
R4973:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4976:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82979429 missense probably benign 0.33
R5027:Fsip2 UTSW 2 82989133 missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82988492 missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82993150 missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82991116 missense probably benign 0.00
R5097:Fsip2 UTSW 2 82991985 missense probably benign
R5119:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82981424 missense probably benign 0.12
R5152:Fsip2 UTSW 2 82978572 missense probably benign 0.43
R5174:Fsip2 UTSW 2 82980741 missense probably benign 0.07
R5193:Fsip2 UTSW 2 82982994 missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82993161 missense probably benign 0.02
R5282:Fsip2 UTSW 2 82978581 missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82988145 missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82989841 missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82975398 missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82990918 missense probably benign 0.00
R5422:Fsip2 UTSW 2 82982228 missense probably benign 0.00
R5481:Fsip2 UTSW 2 82979886 missense probably benign 0.26
R5482:Fsip2 UTSW 2 82985310 missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82950908 missense probably damaging 1.00
R5513:Fsip2 UTSW 2 82950912 missense probably benign 0.07
R5513:Fsip2 UTSW 2 82985198 missense possibly damaging 0.72
R5536:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R5542:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82962746 missense probably benign
R5568:Fsip2 UTSW 2 82986564 missense probably benign 0.25
R5581:Fsip2 UTSW 2 82998128 missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82988095 missense probably benign 0.05
R5672:Fsip2 UTSW 2 82987494 nonsense probably null
R5712:Fsip2 UTSW 2 83008848 missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82977916 missense probably benign 0.33
R5772:Fsip2 UTSW 2 82984740 missense probably benign
R5881:Fsip2 UTSW 2 82984441 missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82992609 missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82988508 nonsense probably null
R5934:Fsip2 UTSW 2 82986748 missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82977491 missense probably benign 0.00
R5974:Fsip2 UTSW 2 82963313 missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82990468 missense probably benign 0.28
R6019:Fsip2 UTSW 2 82987939 missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82992127 missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82985673 missense probably benign 0.01
R6057:Fsip2 UTSW 2 82979433 missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82991044 missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82993768 missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82987945 nonsense probably null
R6161:Fsip2 UTSW 2 82987257 missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82980727 missense probably benign 0.00
R6187:Fsip2 UTSW 2 82982454 missense probably benign 0.33
R6196:Fsip2 UTSW 2 82989883 missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82980441 missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82988898 missense probably benign 0.16
R6349:Fsip2 UTSW 2 82993072 missense probably benign 0.05
R6351:Fsip2 UTSW 2 82992684 missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82983492 missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82982313 missense probably benign
R6621:Fsip2 UTSW 2 82989814 missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82983227 missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82967817 missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82979534 missense probably benign 0.01
R6714:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6749:Fsip2 UTSW 2 82978394 missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82986432 missense probably benign
R6790:Fsip2 UTSW 2 82990939 missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R6795:Fsip2 UTSW 2 82980959 missense probably benign 0.08
R6818:Fsip2 UTSW 2 82985200 missense probably benign 0.04
R6844:Fsip2 UTSW 2 82983625 missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R6945:Fsip2 UTSW 2 82992840 missense probably benign 0.16
R6950:Fsip2 UTSW 2 82985988 missense probably benign 0.03
R6951:Fsip2 UTSW 2 82981949 missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82978717 missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82948286 nonsense probably null
R6989:Fsip2 UTSW 2 82976954 missense probably benign 0.00
R7001:Fsip2 UTSW 2 82986925 missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82989343 missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82990635 missense probably benign 0.25
R7066:Fsip2 UTSW 2 82990891 missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82980734 missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82983152 missense probably benign 0.18
R7099:Fsip2 UTSW 2 82987624 missense probably benign
R7126:Fsip2 UTSW 2 82983141 missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82982741 missense probably benign 0.00
R7165:Fsip2 UTSW 2 82981197 missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82986227 nonsense probably null
R7189:Fsip2 UTSW 2 82993237 missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82989068 missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82983671 missense probably benign
R7228:Fsip2 UTSW 2 82992307 missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82982140 missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82993263 missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82979081 missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82982130 missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82980519 missense possibly damaging 0.91
R7316:Fsip2 UTSW 2 82989691 missense possibly damaging 0.93
R7323:Fsip2 UTSW 2 82989516 missense probably benign 0.07
R7335:Fsip2 UTSW 2 82983118 missense probably benign
R7343:Fsip2 UTSW 2 82979367 missense probably benign 0.07
R7346:Fsip2 UTSW 2 82998180 missense probably benign 0.00
R7389:Fsip2 UTSW 2 82988796 missense possibly damaging 0.51
R7391:Fsip2 UTSW 2 82990319 missense possibly damaging 0.70
R7397:Fsip2 UTSW 2 82985257 missense possibly damaging 0.53
R7426:Fsip2 UTSW 2 82980097 missense probably damaging 0.98
R7450:Fsip2 UTSW 2 82951680 missense probably benign 0.30
R7538:Fsip2 UTSW 2 82988550 missense possibly damaging 0.86
R7542:Fsip2 UTSW 2 82984852 missense possibly damaging 0.96
R7549:Fsip2 UTSW 2 82993993 missense probably damaging 0.99
R7564:Fsip2 UTSW 2 82989017 missense probably benign 0.02
R7565:Fsip2 UTSW 2 82949512 missense probably damaging 0.97
R7583:Fsip2 UTSW 2 82975241 missense probably benign 0.12
R7641:Fsip2 UTSW 2 82986912 nonsense probably null
R7655:Fsip2 UTSW 2 82977542 missense possibly damaging 0.91
R7656:Fsip2 UTSW 2 82977542 missense possibly damaging 0.91
R7665:Fsip2 UTSW 2 82981805 missense probably benign 0.03
R7672:Fsip2 UTSW 2 82990111 missense possibly damaging 0.93
R7764:Fsip2 UTSW 2 82980908 missense possibly damaging 0.93
R7790:Fsip2 UTSW 2 82988379 missense probably benign
R7811:Fsip2 UTSW 2 82998453 missense possibly damaging 0.93
R7838:Fsip2 UTSW 2 82976700 missense probably benign 0.00
R7873:Fsip2 UTSW 2 82949512 missense probably damaging 0.97
R7902:Fsip2 UTSW 2 82977824 missense possibly damaging 0.72
R7920:Fsip2 UTSW 2 82951021 missense possibly damaging 0.94
R7959:Fsip2 UTSW 2 82985776 missense possibly damaging 0.51
R8009:Fsip2 UTSW 2 82988449 missense possibly damaging 0.85
R8031:Fsip2 UTSW 2 82986891 missense probably benign
R8034:Fsip2 UTSW 2 82989355 missense possibly damaging 0.92
R8037:Fsip2 UTSW 2 82985978 missense possibly damaging 0.72
R8110:Fsip2 UTSW 2 82958673 missense probably benign 0.00
R8117:Fsip2 UTSW 2 82992952 missense possibly damaging 0.86
R8138:Fsip2 UTSW 2 82975797 missense possibly damaging 0.83
R8175:Fsip2 UTSW 2 82984744 missense probably benign 0.06
R8175:Fsip2 UTSW 2 82987677 missense probably benign 0.16
R8182:Fsip2 UTSW 2 82976607 missense probably damaging 0.99
R8206:Fsip2 UTSW 2 82990464 missense possibly damaging 0.85
R8229:Fsip2 UTSW 2 82978143 missense possibly damaging 0.63
R8239:Fsip2 UTSW 2 82989343 missense possibly damaging 0.71
R8245:Fsip2 UTSW 2 82981002 missense possibly damaging 0.79
R8303:Fsip2 UTSW 2 82988380 missense probably benign 0.00
R8336:Fsip2 UTSW 2 82990755 missense possibly damaging 0.53
R8347:Fsip2 UTSW 2 82987854 missense probably benign 0.16
R8351:Fsip2 UTSW 2 82991895 missense possibly damaging 0.73
R8352:Fsip2 UTSW 2 82984593 missense probably benign
R8419:Fsip2 UTSW 2 82978619 missense probably damaging 0.96
R8431:Fsip2 UTSW 2 82981566 missense probably damaging 1.00
R8439:Fsip2 UTSW 2 82977086 missense probably benign 0.24
R8452:Fsip2 UTSW 2 82984593 missense probably benign
R8459:Fsip2 UTSW 2 82979678 missense possibly damaging 0.95
R8465:Fsip2 UTSW 2 82979940 missense probably benign 0.26
R8473:Fsip2 UTSW 2 82946992 missense probably damaging 0.99
R8703:Fsip2 UTSW 2 82991527 missense probably damaging 0.98
R8711:Fsip2 UTSW 2 82984902 missense possibly damaging 0.53
R8713:Fsip2 UTSW 2 82981109 missense probably damaging 1.00
R8789:Fsip2 UTSW 2 82985478 missense possibly damaging 0.73
R8805:Fsip2 UTSW 2 82983109 missense possibly damaging 0.46
R8840:Fsip2 UTSW 2 82991262 missense probably benign 0.03
R8855:Fsip2 UTSW 2 82980177 missense probably benign 0.04
R8866:Fsip2 UTSW 2 82980177 missense probably benign 0.04
R8875:Fsip2 UTSW 2 82990438 missense possibly damaging 0.95
R8883:Fsip2 UTSW 2 82979180 missense possibly damaging 0.68
R8903:Fsip2 UTSW 2 82977337 missense possibly damaging 0.83
R8907:Fsip2 UTSW 2 82986640 missense probably benign 0.20
R8912:Fsip2 UTSW 2 82980594 missense probably benign
R8926:Fsip2 UTSW 2 82993583 missense possibly damaging 0.84
R8991:Fsip2 UTSW 2 82985026 missense probably benign 0.33
R9014:Fsip2 UTSW 2 82976554 missense probably benign 0.32
R9014:Fsip2 UTSW 2 82986731 missense possibly damaging 0.71
R9039:Fsip2 UTSW 2 82998201 missense probably benign 0.32
R9054:Fsip2 UTSW 2 82975836 missense possibly damaging 0.68
R9114:Fsip2 UTSW 2 82976957 missense probably benign 0.00
R9124:Fsip2 UTSW 2 82985759 missense probably benign 0.00
R9131:Fsip2 UTSW 2 82982826 missense probably benign
R9149:Fsip2 UTSW 2 82982030 missense possibly damaging 0.86
R9180:Fsip2 UTSW 2 82985230 missense possibly damaging 0.96
R9192:Fsip2 UTSW 2 82987500 missense probably benign 0.06
R9216:Fsip2 UTSW 2 82990081 missense probably damaging 0.99
R9218:Fsip2 UTSW 2 82992718 missense probably damaging 0.97
R9222:Fsip2 UTSW 2 82985614 missense probably benign 0.00
R9262:Fsip2 UTSW 2 82977318 missense probably benign 0.00
R9340:Fsip2 UTSW 2 82988260 missense possibly damaging 0.71
R9342:Fsip2 UTSW 2 82988403 missense possibly damaging 0.71
R9368:Fsip2 UTSW 2 82980695 missense possibly damaging 0.68
R9372:Fsip2 UTSW 2 82992412 missense possibly damaging 0.71
R9385:Fsip2 UTSW 2 82989449 missense possibly damaging 0.84
R9432:Fsip2 UTSW 2 82975563 missense probably damaging 0.98
R9434:Fsip2 UTSW 2 82986358 missense possibly damaging 0.71
R9445:Fsip2 UTSW 2 82975788 missense probably damaging 0.99
R9472:Fsip2 UTSW 2 82986941 missense possibly damaging 0.85
R9496:Fsip2 UTSW 2 82962718 missense probably benign
R9523:Fsip2 UTSW 2 82977628 missense probably damaging 0.99
R9567:Fsip2 UTSW 2 82967829 missense probably benign
R9636:Fsip2 UTSW 2 82990219 missense possibly damaging 0.52
R9643:Fsip2 UTSW 2 82991640 missense possibly damaging 0.53
R9695:Fsip2 UTSW 2 82975882 missense probably benign
R9705:Fsip2 UTSW 2 82993290 missense probably benign
R9739:Fsip2 UTSW 2 82993552 missense possibly damaging 0.71
R9751:Fsip2 UTSW 2 82987897 missense probably benign 0.00
R9761:Fsip2 UTSW 2 82991650 missense probably benign 0.00
R9798:Fsip2 UTSW 2 82979881 nonsense probably null
RF003:Fsip2 UTSW 2 82991521 missense probably benign 0.02
RF005:Fsip2 UTSW 2 82992532 missense probably benign 0.04
RF008:Fsip2 UTSW 2 82977840 missense probably benign
RF028:Fsip2 UTSW 2 82994008 frame shift probably null
RF029:Fsip2 UTSW 2 82994008 frame shift probably null
RF036:Fsip2 UTSW 2 82984363 critical splice acceptor site probably benign
RF038:Fsip2 UTSW 2 82994008 frame shift probably null
RF062:Fsip2 UTSW 2 82984363 critical splice acceptor site probably benign
X0018:Fsip2 UTSW 2 82982507 nonsense probably null
X0020:Fsip2 UTSW 2 82951020 missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82954946 missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82976778 missense probably benign 0.35
X0066:Fsip2 UTSW 2 82987463 missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82975448 missense probably damaging 0.96
Z1088:Fsip2 UTSW 2 82987653 missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82988634 missense possibly damaging 0.85
Z1176:Fsip2 UTSW 2 82989665 missense probably benign 0.02
Z1177:Fsip2 UTSW 2 82946960 missense probably damaging 0.99
Z1177:Fsip2 UTSW 2 82984524 missense probably damaging 0.98
Z1177:Fsip2 UTSW 2 82987203 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTTCAGCTTCAGTGGCTCAAAC -3'
(R):5'- GAGGTGTCATATTGTACAGCCC -3'

Sequencing Primer
(F):5'- TTCAGTGGCTCAAACCTGCAAG -3'
(R):5'- TCATATTGTACAGCCCTGTGTAG -3'
Posted On 2022-10-06