Incidental Mutation 'R9680:2410089E03Rik'
ID 728510
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene Name RIKEN cDNA 2410089E03 gene
Synonyms b2b012Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9680 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 8169106-8271158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8202301 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1077 (N1077S)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000110617
AA Change: N1077S

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: N1077S

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,755,202 Y502N probably damaging Het
Adam6a T A 12: 113,545,864 L619* probably null Het
Akap9 A T 5: 3,961,587 R763S probably benign Het
Akt3 G A 1: 177,131,073 P24S probably damaging Het
Ano2 A T 6: 125,880,419 probably null Het
B4galnt4 G A 7: 141,068,044 R491Q possibly damaging Het
Bahcc1 A G 11: 120,272,460 D528G possibly damaging Het
Camk1g G T 1: 193,348,175 Q409K probably benign Het
Cdh3 T A 8: 106,547,764 N638K probably benign Het
Cgnl1 T A 9: 71,655,350 E882D possibly damaging Het
Cpxm2 C T 7: 132,059,922 E379K probably damaging Het
Cyp3a16 A G 5: 145,452,880 L225P probably damaging Het
Dchs1 T C 7: 105,762,418 E1497G probably damaging Het
Denr T A 5: 123,927,054 S157T possibly damaging Het
Disp3 A G 4: 148,271,644 I253T probably damaging Het
Dlgap2 C T 8: 14,846,653 T1043M probably damaging Het
Epb41l5 T C 1: 119,608,074 T355A probably damaging Het
Etv6 G A 6: 134,036,099 probably benign Het
Fbn1 T C 2: 125,468,564 I141V probably benign Het
Fsip2 T G 2: 82,988,928 S5002A probably benign Het
Gbf1 T G 19: 46,283,398 V1576G probably damaging Het
Gm853 A G 4: 130,221,734 V7A probably benign Het
Gmfg T A 7: 28,441,308 probably null Het
Gsdmc4 T C 15: 63,902,857 E25G possibly damaging Het
Igkv6-23 A T 6: 70,260,900 L12M possibly damaging Het
Kank1 G A 19: 25,410,774 V604M probably damaging Het
Kctd1 A G 18: 15,007,765 V40A probably damaging Het
Krt222 T C 11: 99,236,239 K185R possibly damaging Het
Lipm T C 19: 34,112,094 F151L probably damaging Het
Lrrc2 A T 9: 110,962,642 N154I probably damaging Het
Map1a T A 2: 121,302,384 M1227K probably damaging Het
Med1 T C 11: 98,180,288 T78A probably damaging Het
Mrm1 A G 11: 84,819,318 S19P possibly damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nap1l1 A G 10: 111,494,796 Y354C probably damaging Het
Npr1 A G 3: 90,461,141 V474A probably benign Het
Nyap1 A T 5: 137,735,578 S398T probably damaging Het
Obox7 C T 7: 14,664,142 Q36* probably null Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr767 A T 10: 129,079,489 I158N probably benign Het
P3h1 T A 4: 119,233,231 L92H probably benign Het
Pappa2 T C 1: 158,782,248 T1548A possibly damaging Het
Pnisr A G 4: 21,873,586 E443G probably damaging Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Prom1 A T 5: 44,032,942 probably null Het
Rbm27 A T 18: 42,322,121 Q646H probably damaging Het
Scamp3 C T 3: 89,180,254 R134* probably null Het
Scrt2 T C 2: 152,082,098 C17R probably benign Het
Setbp1 A G 18: 78,859,283 S390P probably benign Het
Shank2 A T 7: 144,411,100 D815V probably damaging Het
Sirt7 G A 11: 120,620,470 T285M Het
Sis T G 3: 72,956,288 S206R probably benign Het
Slc24a4 T G 12: 102,227,075 D206E possibly damaging Het
Slc26a4 C A 12: 31,535,293 G501C probably damaging Het
Sptb T C 12: 76,630,715 N115S probably damaging Het
Srprb T C 9: 103,197,608 T112A possibly damaging Het
Tbk1 G T 10: 121,553,936 A537E probably benign Het
Tbx19 T A 1: 165,142,498 H274L probably damaging Het
Tmem130 A G 5: 144,737,423 S394P probably damaging Het
Tmem40 A G 6: 115,741,556 S104P possibly damaging Het
Tmprss2 T A 16: 97,578,626 Q158L probably damaging Het
Tnip1 A T 11: 54,938,050 V97D possibly damaging Het
Tpr T A 1: 150,439,136 S1985T probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trio G T 15: 27,744,072 N2591K possibly damaging Het
Ushbp1 A T 8: 71,385,929 C618S possibly damaging Het
Usp34 A G 11: 23,367,385 S834G possibly damaging Het
Vmn2r103 C A 17: 19,799,263 C536* probably null Het
Vmn2r124 T A 17: 18,073,496 V615D probably damaging Het
Zbtb38 G A 9: 96,688,344 T229I probably benign Het
Zfhx4 T A 3: 5,400,596 V1963E probably damaging Het
Zfp142 G A 1: 74,571,774 T954M probably benign Het
Zgrf1 A G 3: 127,615,567 Y1730C probably benign Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
R7446:2410089E03Rik UTSW 15 8232080 missense probably damaging 0.98
R7539:2410089E03Rik UTSW 15 8201244 missense probably benign 0.19
R7543:2410089E03Rik UTSW 15 8225392 missense unknown
R7558:2410089E03Rik UTSW 15 8225367 missense unknown
R7629:2410089E03Rik UTSW 15 8227067 nonsense probably null
R7635:2410089E03Rik UTSW 15 8226920 missense probably benign 0.01
R7644:2410089E03Rik UTSW 15 8223127 missense probably benign 0.00
R7705:2410089E03Rik UTSW 15 8182252 missense probably damaging 1.00
R7752:2410089E03Rik UTSW 15 8269706 missense unknown
R7754:2410089E03Rik UTSW 15 8243826 missense possibly damaging 0.53
R7757:2410089E03Rik UTSW 15 8252227 missense unknown
R7836:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7875:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7901:2410089E03Rik UTSW 15 8269706 missense unknown
R7983:2410089E03Rik UTSW 15 8221815 missense probably benign 0.01
R8030:2410089E03Rik UTSW 15 8230303 missense probably damaging 1.00
R8088:2410089E03Rik UTSW 15 8186318 missense probably benign 0.00
R8231:2410089E03Rik UTSW 15 8219027 missense probably benign 0.16
R8443:2410089E03Rik UTSW 15 8201151 missense probably benign 0.03
R8480:2410089E03Rik UTSW 15 8187458 missense possibly damaging 0.63
R8693:2410089E03Rik UTSW 15 8229008 missense probably benign 0.15
R8785:2410089E03Rik UTSW 15 8174760 missense probably benign 0.39
R8791:2410089E03Rik UTSW 15 8187260 missense probably damaging 1.00
R8822:2410089E03Rik UTSW 15 8171778 missense probably damaging 1.00
R8831:2410089E03Rik UTSW 15 8182136 missense probably benign 0.09
R8932:2410089E03Rik UTSW 15 8194375 missense probably damaging 1.00
R8968:2410089E03Rik UTSW 15 8201281 missense possibly damaging 0.84
R8973:2410089E03Rik UTSW 15 8203793 missense probably damaging 1.00
R9036:2410089E03Rik UTSW 15 8223138 missense possibly damaging 0.63
R9134:2410089E03Rik UTSW 15 8199232 missense probably damaging 0.99
R9197:2410089E03Rik UTSW 15 8251052 missense unknown
R9259:2410089E03Rik UTSW 15 8203303 missense possibly damaging 0.82
R9269:2410089E03Rik UTSW 15 8219016 missense probably damaging 0.97
R9294:2410089E03Rik UTSW 15 8203327 missense probably benign 0.00
R9328:2410089E03Rik UTSW 15 8186208 missense probably damaging 1.00
R9563:2410089E03Rik UTSW 15 8187079 missense probably benign 0.20
R9721:2410089E03Rik UTSW 15 8225409 missense unknown
R9779:2410089E03Rik UTSW 15 8201302 missense possibly damaging 0.93
R9780:2410089E03Rik UTSW 15 8228639 missense probably benign 0.00
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Z1177:2410089E03Rik UTSW 15 8174972 missense probably damaging 1.00
Z1177:2410089E03Rik UTSW 15 8209989 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGAGCAATTGTCTCCATAGTTTC -3'
(R):5'- GTGCTCCCATGATTAAGTATAAAGACC -3'

Sequencing Primer
(F):5'- CTCTTGTTACAGGTCCAAG -3'
(R):5'- GAACTCACTTTGTAGACCAGGCTG -3'
Posted On 2022-10-06