Incidental Mutation 'R9682:Nup210l'
ID 728603
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R9682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90051469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 538 (Y538N)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect possibly damaging
Transcript: ENSMUST00000029548
AA Change: Y538N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: Y538N

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200410
AA Change: Y538N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: Y538N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,752,507 (GRCm39) M493L probably benign Het
Abcb5 T A 12: 118,896,328 (GRCm39) I334F probably damaging Het
Acad9 C T 3: 36,136,268 (GRCm39) A351V possibly damaging Het
Adgrg6 A T 10: 14,316,128 (GRCm39) N536K possibly damaging Het
Alk A T 17: 72,182,058 (GRCm39) L1322M possibly damaging Het
Atp2b1 T C 10: 98,815,662 (GRCm39) V102A possibly damaging Het
Atp8b3 T C 10: 80,371,230 (GRCm39) N48S probably damaging Het
B3gnt4 A T 5: 123,649,516 (GRCm39) I294L probably benign Het
Bnip3 A G 7: 138,496,445 (GRCm39) S88P probably damaging Het
Ccr2 A G 9: 123,906,176 (GRCm39) Y152C probably damaging Het
Cd28 T C 1: 60,804,505 (GRCm39) L161P probably damaging Het
Clcn4 C T 7: 7,299,797 (GRCm39) V11M probably benign Het
Clec4g T A 8: 3,757,713 (GRCm39) S79C unknown Het
Cux1 A T 5: 136,337,116 (GRCm39) S799T probably benign Het
Cyp2t4 A T 7: 26,857,611 (GRCm39) H408L probably damaging Het
Cyp3a41a A T 5: 145,652,326 (GRCm39) W58R possibly damaging Het
Dicer1 A G 12: 104,672,484 (GRCm39) V921A probably damaging Het
Dpysl3 A G 18: 43,491,313 (GRCm39) L268P probably damaging Het
Dus3l G A 17: 57,076,770 (GRCm39) V626I probably benign Het
Epb41 C A 4: 131,655,820 (GRCm39) D337Y Het
Fer1l6 A G 15: 58,422,113 (GRCm39) T104A probably benign Het
Fgd4 T C 16: 16,302,202 (GRCm39) T118A probably benign Het
Gabra4 T A 5: 71,798,415 (GRCm39) Y188F possibly damaging Het
Gm28168 A T 1: 117,875,824 (GRCm39) H151L probably damaging Het
Gm7995 A G 14: 42,133,395 (GRCm39) I91V Het
Heg1 A G 16: 33,541,298 (GRCm39) E485G probably benign Het
Hirip3 A G 7: 126,462,021 (GRCm39) D73G probably benign Het
Igdcc3 A G 9: 65,091,332 (GRCm39) D684G probably benign Het
Kif15 A G 9: 122,815,712 (GRCm39) E502G probably damaging Het
Lrrc31 C T 3: 30,743,423 (GRCm39) V181I probably damaging Het
Lrrc7 G T 3: 157,882,954 (GRCm39) S446R possibly damaging Het
Lyst A G 13: 13,831,526 (GRCm39) E1650G probably benign Het
Map3k6 A G 4: 132,975,419 (GRCm39) Y718C possibly damaging Het
Mta1 T C 12: 113,095,384 (GRCm39) probably null Het
Muc16 C T 9: 18,553,874 (GRCm39) G4140R unknown Het
Nfe2l1 A C 11: 96,710,944 (GRCm39) I428M probably benign Het
Nxpe4 G A 9: 48,304,248 (GRCm39) V112M probably benign Het
Or1e16 C T 11: 73,286,025 (GRCm39) M274I probably benign Het
Or4c112 T A 2: 88,854,296 (GRCm39) Q17L possibly damaging Het
Or4k40 T A 2: 111,250,737 (GRCm39) K186N probably benign Het
Or52d3 G T 7: 104,229,434 (GRCm39) A194S probably damaging Het
Or8g24 G A 9: 38,989,874 (GRCm39) H56Y possibly damaging Het
Palm A G 10: 79,655,039 (GRCm39) T266A possibly damaging Het
Pdzph1 T G 17: 59,257,262 (GRCm39) K925N probably damaging Het
Pfkfb3 G T 2: 11,491,058 (GRCm39) Q179K probably benign Het
Phtf1 A G 3: 103,901,214 (GRCm39) Q421R possibly damaging Het
Pip5k1b A T 19: 24,356,318 (GRCm39) S207T probably damaging Het
Pkd2 T C 5: 104,626,790 (GRCm39) V324A probably damaging Het
Plcxd1 A T 5: 110,251,477 (GRCm39) N351I probably damaging Het
Prr14l G A 5: 32,988,023 (GRCm39) P491S probably benign Het
Rxfp2 A T 5: 149,966,564 (GRCm39) R101* probably null Het
Saxo2 T G 7: 82,292,881 (GRCm39) K72T probably benign Het
Sema3b T A 9: 107,481,013 (GRCm39) D108V probably damaging Het
Sh3gl2 A G 4: 85,295,748 (GRCm39) D150G probably damaging Het
Slc6a12 G A 6: 121,340,704 (GRCm39) M544I probably benign Het
Spag6l T C 16: 16,646,981 (GRCm39) probably null Het
Stat3 A G 11: 100,785,593 (GRCm39) F512L probably benign Het
Stk39 A G 2: 68,196,449 (GRCm39) S327P probably damaging Het
Tjp3 C T 10: 81,109,645 (GRCm39) E853K probably benign Het
Tmem30c A T 16: 57,111,180 (GRCm39) S31T probably benign Het
Tpte A T 8: 22,841,493 (GRCm39) D495V probably damaging Het
Ugt2b5 A T 5: 87,287,522 (GRCm39) M215K probably damaging Het
Vinac1 T C 2: 128,875,529 (GRCm39) S1246G unknown Het
Vsig2 T C 9: 37,451,771 (GRCm39) L135S probably benign Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCCAAGCATGCACAAGGATC -3'
(R):5'- TGCTTATCCGAGTTGAGATCGAG -3'

Sequencing Primer
(F):5'- TCTCACTGTAGCTGAGGATGAAC -3'
(R):5'- TTGAGATCGAGGGGTAAGTGC -3'
Posted On 2022-10-06