Mutagenetix > Incidental Mutation

Incidental Mutation 'R9682:Atp8b3'

728638

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R9682 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80535396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 48 (N48S)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000219648] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably damaging
Transcript: ENSMUST00000020383
AA Change: N48S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: N48S

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219648

Predicted Effect

probably damaging
Transcript: ENSMUST00000220326
AA Change: N48S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	T	5: 8,702,507	M493L	probably benign	Het
Abcb5	T	A	12: 118,932,593	I334F	probably damaging	Het
Acad9	C	T	3: 36,082,119	A351V	possibly damaging	Het
Adgrg6	A	T	10: 14,440,384	N536K	possibly damaging	Het
Alk	A	T	17: 71,875,063	L1322M	possibly damaging	Het
Atp2b1	T	C	10: 98,979,800	V102A	possibly damaging	Het
B3gnt4	A	T	5: 123,511,453	I294L	probably benign	Het
Bnip3	A	G	7: 138,894,716	S88P	probably damaging	Het
Ccr2	A	G	9: 124,106,139	Y152C	probably damaging	Het
Cd28	T	C	1: 60,765,346	L161P	probably damaging	Het
Clcn4	C	T	7: 7,296,798	V11M	probably benign	Het
Clec4g	T	A	8: 3,707,713	S79C	unknown	Het
Cux1	A	T	5: 136,308,262	S799T	probably benign	Het
Cyp2t4	A	T	7: 27,158,186	H408L	probably damaging	Het
Cyp3a41a	A	T	5: 145,715,516	W58R	possibly damaging	Het
Dicer1	A	G	12: 104,706,225	V921A	probably damaging	Het
Dpysl3	A	G	18: 43,358,248	L268P	probably damaging	Het
Dus3l	G	A	17: 56,769,770	V626I	probably benign	Het
Epb41	C	A	4: 131,928,509	D337Y		Het
Fer1l6	A	G	15: 58,550,264	T104A	probably benign	Het
Fgd4	T	C	16: 16,484,338	T118A	probably benign	Het
Gabra4	T	A	5: 71,641,072	Y188F	possibly damaging	Het
Gm14025	T	C	2: 129,033,609	S1246G	unknown	Het
Gm28168	A	T	1: 117,948,094	H151L	probably damaging	Het
Gm7995	A	G	14: 42,311,438	I91V		Het
Heg1	A	G	16: 33,720,928	E485G	probably benign	Het
Hirip3	A	G	7: 126,862,849	D73G	probably benign	Het
Igdcc3	A	G	9: 65,184,050	D684G	probably benign	Het
Kif15	A	G	9: 122,986,647	E502G	probably damaging	Het
Lrrc31	C	T	3: 30,689,274	V181I	probably damaging	Het
Lrrc7	G	T	3: 158,177,317	S446R	possibly damaging	Het
Lyst	A	G	13: 13,656,941	E1650G	probably benign	Het
Map3k6	A	G	4: 133,248,108	Y718C	possibly damaging	Het
Mta1	T	C	12: 113,131,764		probably null	Het
Muc16	C	T	9: 18,642,578	G4140R	unknown	Het
Nfe2l1	A	C	11: 96,820,118	I428M	probably benign	Het
Nup210l	T	A	3: 90,144,162	Y538N	possibly damaging	Het
Nxpe4	G	A	9: 48,392,948	V112M	probably benign	Het
Olfr1	C	T	11: 73,395,199	M274I	probably benign	Het
Olfr1217	T	A	2: 89,023,952	Q17L	possibly damaging	Het
Olfr1286	T	A	2: 111,420,392	K186N	probably benign	Het
Olfr653	G	T	7: 104,580,227	A194S	probably damaging	Het
Olfr938	G	A	9: 39,078,578	H56Y	possibly damaging	Het
Palm	A	G	10: 79,819,205	T266A	possibly damaging	Het
Pdzph1	T	G	17: 58,950,267	K925N	probably damaging	Het
Pfkfb3	G	T	2: 11,486,247	Q179K	probably benign	Het
Phtf1	A	G	3: 103,993,898	Q421R	possibly damaging	Het
Pip5k1b	A	T	19: 24,378,954	S207T	probably damaging	Het
Pkd2	T	C	5: 104,478,924	V324A	probably damaging	Het
Plcxd1	A	T	5: 110,103,611	N351I	probably damaging	Het
Prr14l	G	A	5: 32,830,679	P491S	probably benign	Het
Rxfp2	A	T	5: 150,043,099	R101*	probably null	Het
Saxo2	T	G	7: 82,643,673	K72T	probably benign	Het
Sema3b	T	A	9: 107,603,814	D108V	probably damaging	Het
Sh3gl2	A	G	4: 85,377,511	D150G	probably damaging	Het
Slc6a12	G	A	6: 121,363,745	M544I	probably benign	Het
Spag6l	T	C	16: 16,829,117		probably null	Het
Stat3	A	G	11: 100,894,767	F512L	probably benign	Het
Stk39	A	G	2: 68,366,105	S327P	probably damaging	Het
Tjp3	C	T	10: 81,273,811	E853K	probably benign	Het
Tmem30c	A	T	16: 57,290,817	S31T	probably benign	Het
Tpte	A	T	8: 22,351,477	D495V	probably damaging	Het
Ugt2b5	A	T	5: 87,139,663	M215K	probably damaging	Het
Vsig2	T	C	9: 37,540,475	L135S	probably benign	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTTCAGTGAGAAGCCACCAG -3'
(R):5'- CTCCATCAAGCAGCAGGTGTTC -3'

Sequencing Primer
(F):5'- ACCAGGGTGCTCAGGCTAC -3'
(R):5'- CAGCAGGTGTTCAATAAATGCTG -3'

Posted On

2022-10-06