Incidental Mutation 'R9682:Atp8b3'
ID 728638
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80371230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 48 (N48S)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000219648] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably damaging
Transcript: ENSMUST00000020383
AA Change: N48S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: N48S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219648
Predicted Effect probably damaging
Transcript: ENSMUST00000220326
AA Change: N48S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,752,507 (GRCm39) M493L probably benign Het
Abcb5 T A 12: 118,896,328 (GRCm39) I334F probably damaging Het
Acad9 C T 3: 36,136,268 (GRCm39) A351V possibly damaging Het
Adgrg6 A T 10: 14,316,128 (GRCm39) N536K possibly damaging Het
Alk A T 17: 72,182,058 (GRCm39) L1322M possibly damaging Het
Atp2b1 T C 10: 98,815,662 (GRCm39) V102A possibly damaging Het
B3gnt4 A T 5: 123,649,516 (GRCm39) I294L probably benign Het
Bnip3 A G 7: 138,496,445 (GRCm39) S88P probably damaging Het
Ccr2 A G 9: 123,906,176 (GRCm39) Y152C probably damaging Het
Cd28 T C 1: 60,804,505 (GRCm39) L161P probably damaging Het
Clcn4 C T 7: 7,299,797 (GRCm39) V11M probably benign Het
Clec4g T A 8: 3,757,713 (GRCm39) S79C unknown Het
Cux1 A T 5: 136,337,116 (GRCm39) S799T probably benign Het
Cyp2t4 A T 7: 26,857,611 (GRCm39) H408L probably damaging Het
Cyp3a41a A T 5: 145,652,326 (GRCm39) W58R possibly damaging Het
Dicer1 A G 12: 104,672,484 (GRCm39) V921A probably damaging Het
Dpysl3 A G 18: 43,491,313 (GRCm39) L268P probably damaging Het
Dus3l G A 17: 57,076,770 (GRCm39) V626I probably benign Het
Epb41 C A 4: 131,655,820 (GRCm39) D337Y Het
Fer1l6 A G 15: 58,422,113 (GRCm39) T104A probably benign Het
Fgd4 T C 16: 16,302,202 (GRCm39) T118A probably benign Het
Gabra4 T A 5: 71,798,415 (GRCm39) Y188F possibly damaging Het
Gm28168 A T 1: 117,875,824 (GRCm39) H151L probably damaging Het
Gm7995 A G 14: 42,133,395 (GRCm39) I91V Het
Heg1 A G 16: 33,541,298 (GRCm39) E485G probably benign Het
Hirip3 A G 7: 126,462,021 (GRCm39) D73G probably benign Het
Igdcc3 A G 9: 65,091,332 (GRCm39) D684G probably benign Het
Kif15 A G 9: 122,815,712 (GRCm39) E502G probably damaging Het
Lrrc31 C T 3: 30,743,423 (GRCm39) V181I probably damaging Het
Lrrc7 G T 3: 157,882,954 (GRCm39) S446R possibly damaging Het
Lyst A G 13: 13,831,526 (GRCm39) E1650G probably benign Het
Map3k6 A G 4: 132,975,419 (GRCm39) Y718C possibly damaging Het
Mta1 T C 12: 113,095,384 (GRCm39) probably null Het
Muc16 C T 9: 18,553,874 (GRCm39) G4140R unknown Het
Nfe2l1 A C 11: 96,710,944 (GRCm39) I428M probably benign Het
Nup210l T A 3: 90,051,469 (GRCm39) Y538N possibly damaging Het
Nxpe4 G A 9: 48,304,248 (GRCm39) V112M probably benign Het
Or1e16 C T 11: 73,286,025 (GRCm39) M274I probably benign Het
Or4c112 T A 2: 88,854,296 (GRCm39) Q17L possibly damaging Het
Or4k40 T A 2: 111,250,737 (GRCm39) K186N probably benign Het
Or52d3 G T 7: 104,229,434 (GRCm39) A194S probably damaging Het
Or8g24 G A 9: 38,989,874 (GRCm39) H56Y possibly damaging Het
Palm A G 10: 79,655,039 (GRCm39) T266A possibly damaging Het
Pdzph1 T G 17: 59,257,262 (GRCm39) K925N probably damaging Het
Pfkfb3 G T 2: 11,491,058 (GRCm39) Q179K probably benign Het
Phtf1 A G 3: 103,901,214 (GRCm39) Q421R possibly damaging Het
Pip5k1b A T 19: 24,356,318 (GRCm39) S207T probably damaging Het
Pkd2 T C 5: 104,626,790 (GRCm39) V324A probably damaging Het
Plcxd1 A T 5: 110,251,477 (GRCm39) N351I probably damaging Het
Prr14l G A 5: 32,988,023 (GRCm39) P491S probably benign Het
Rxfp2 A T 5: 149,966,564 (GRCm39) R101* probably null Het
Saxo2 T G 7: 82,292,881 (GRCm39) K72T probably benign Het
Sema3b T A 9: 107,481,013 (GRCm39) D108V probably damaging Het
Sh3gl2 A G 4: 85,295,748 (GRCm39) D150G probably damaging Het
Slc6a12 G A 6: 121,340,704 (GRCm39) M544I probably benign Het
Spag6l T C 16: 16,646,981 (GRCm39) probably null Het
Stat3 A G 11: 100,785,593 (GRCm39) F512L probably benign Het
Stk39 A G 2: 68,196,449 (GRCm39) S327P probably damaging Het
Tjp3 C T 10: 81,109,645 (GRCm39) E853K probably benign Het
Tmem30c A T 16: 57,111,180 (GRCm39) S31T probably benign Het
Tpte A T 8: 22,841,493 (GRCm39) D495V probably damaging Het
Ugt2b5 A T 5: 87,287,522 (GRCm39) M215K probably damaging Het
Vinac1 T C 2: 128,875,529 (GRCm39) S1246G unknown Het
Vsig2 T C 9: 37,451,771 (GRCm39) L135S probably benign Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTCAGTGAGAAGCCACCAG -3'
(R):5'- CTCCATCAAGCAGCAGGTGTTC -3'

Sequencing Primer
(F):5'- ACCAGGGTGCTCAGGCTAC -3'
(R):5'- CAGCAGGTGTTCAATAAATGCTG -3'
Posted On 2022-10-06