Incidental Mutation 'R9682:Fer1l6'
ID 728649
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R9682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58550264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 104 (T104A)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably benign
Transcript: ENSMUST00000161028
AA Change: T104A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: T104A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,702,507 M493L probably benign Het
Abcb5 T A 12: 118,932,593 I334F probably damaging Het
Acad9 C T 3: 36,082,119 A351V possibly damaging Het
Adgrg6 A T 10: 14,440,384 N536K possibly damaging Het
Alk A T 17: 71,875,063 L1322M possibly damaging Het
Atp2b1 T C 10: 98,979,800 V102A possibly damaging Het
Atp8b3 T C 10: 80,535,396 N48S probably damaging Het
B3gnt4 A T 5: 123,511,453 I294L probably benign Het
Bnip3 A G 7: 138,894,716 S88P probably damaging Het
Ccr2 A G 9: 124,106,139 Y152C probably damaging Het
Cd28 T C 1: 60,765,346 L161P probably damaging Het
Clcn4 C T 7: 7,296,798 V11M probably benign Het
Clec4g T A 8: 3,707,713 S79C unknown Het
Cux1 A T 5: 136,308,262 S799T probably benign Het
Cyp2t4 A T 7: 27,158,186 H408L probably damaging Het
Cyp3a41a A T 5: 145,715,516 W58R possibly damaging Het
Dicer1 A G 12: 104,706,225 V921A probably damaging Het
Dpysl3 A G 18: 43,358,248 L268P probably damaging Het
Dus3l G A 17: 56,769,770 V626I probably benign Het
Epb41 C A 4: 131,928,509 D337Y Het
Fgd4 T C 16: 16,484,338 T118A probably benign Het
Gabra4 T A 5: 71,641,072 Y188F possibly damaging Het
Gm14025 T C 2: 129,033,609 S1246G unknown Het
Gm28168 A T 1: 117,948,094 H151L probably damaging Het
Gm7995 A G 14: 42,311,438 I91V Het
Heg1 A G 16: 33,720,928 E485G probably benign Het
Hirip3 A G 7: 126,862,849 D73G probably benign Het
Igdcc3 A G 9: 65,184,050 D684G probably benign Het
Kif15 A G 9: 122,986,647 E502G probably damaging Het
Lrrc31 C T 3: 30,689,274 V181I probably damaging Het
Lrrc7 G T 3: 158,177,317 S446R possibly damaging Het
Lyst A G 13: 13,656,941 E1650G probably benign Het
Map3k6 A G 4: 133,248,108 Y718C possibly damaging Het
Mta1 T C 12: 113,131,764 probably null Het
Muc16 C T 9: 18,642,578 G4140R unknown Het
Nfe2l1 A C 11: 96,820,118 I428M probably benign Het
Nup210l T A 3: 90,144,162 Y538N possibly damaging Het
Nxpe4 G A 9: 48,392,948 V112M probably benign Het
Olfr1 C T 11: 73,395,199 M274I probably benign Het
Olfr1217 T A 2: 89,023,952 Q17L possibly damaging Het
Olfr1286 T A 2: 111,420,392 K186N probably benign Het
Olfr653 G T 7: 104,580,227 A194S probably damaging Het
Olfr938 G A 9: 39,078,578 H56Y possibly damaging Het
Palm A G 10: 79,819,205 T266A possibly damaging Het
Pdzph1 T G 17: 58,950,267 K925N probably damaging Het
Pfkfb3 G T 2: 11,486,247 Q179K probably benign Het
Phtf1 A G 3: 103,993,898 Q421R possibly damaging Het
Pip5k1b A T 19: 24,378,954 S207T probably damaging Het
Pkd2 T C 5: 104,478,924 V324A probably damaging Het
Plcxd1 A T 5: 110,103,611 N351I probably damaging Het
Prr14l G A 5: 32,830,679 P491S probably benign Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Saxo2 T G 7: 82,643,673 K72T probably benign Het
Sema3b T A 9: 107,603,814 D108V probably damaging Het
Sh3gl2 A G 4: 85,377,511 D150G probably damaging Het
Slc6a12 G A 6: 121,363,745 M544I probably benign Het
Spag6l T C 16: 16,829,117 probably null Het
Stat3 A G 11: 100,894,767 F512L probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tjp3 C T 10: 81,273,811 E853K probably benign Het
Tmem30c A T 16: 57,290,817 S31T probably benign Het
Tpte A T 8: 22,351,477 D495V probably damaging Het
Ugt2b5 A T 5: 87,139,663 M215K probably damaging Het
Vsig2 T C 9: 37,540,475 L135S probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCTGACTAAGATCCATGATGG -3'
(R):5'- TGTAAAATGGGCTGTTGGTCCC -3'

Sequencing Primer
(F):5'- TCCATGATGGAGAGATCAAATCTC -3'
(R):5'- GGTCCCTTCCTTCACTGTGGG -3'
Posted On 2022-10-06