Mutagenetix > Incidental Mutation

Incidental Mutation 'R9683:Astn1'

728663

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R9683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

158189843-158519351 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158491619 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1007 (I1007V)

Ref Sequence

ENSEMBL: ENSMUSP00000142322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000192821] [ENSMUST00000193042] [ENSMUST00000195311]

AlphaFold

Q61137

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046110
AA Change: I999V

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: I999V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192821
AA Change: I23V

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000141260
Gene: ENSMUSG00000026587
AA Change: I23V

Domain	Start	End	E-Value	Type
FN3	46	158	2.8e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193042
AA Change: I1007V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: I1007V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194217

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195311
AA Change: I999V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: I999V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	T	3: 124,200,095 (GRCm39)	G499D	probably benign	Het
Acr	T	A	15: 89,457,440 (GRCm39)	Y229*	probably null	Het
Adam6b	G	T	12: 113,454,176 (GRCm39)	C331F	probably benign	Het
Ahnak	T	C	19: 8,984,719 (GRCm39)	V2001A	possibly damaging	Het
Ankrd11	C	T	8: 123,617,682 (GRCm39)	A2057T	probably benign	Het
Anln	A	T	9: 22,283,536 (GRCm39)	C432*	probably null	Het
Aox4	T	C	1: 58,278,462 (GRCm39)		probably null	Het
Bicral	T	C	17: 47,122,944 (GRCm39)	D649G	possibly damaging	Het
C1qbp	G	A	11: 70,873,749 (GRCm39)	R10C	probably damaging	Het
Cass4	C	T	2: 172,268,656 (GRCm39)	P246L	probably damaging	Het
Celsr3	T	A	9: 108,704,522 (GRCm39)	V335E	probably damaging	Het
Cfap52	T	A	11: 67,822,639 (GRCm39)	T411S	probably benign	Het
Cnot6	A	T	11: 49,580,164 (GRCm39)	L43I	possibly damaging	Het
Col9a3	G	A	2: 180,248,322 (GRCm39)		probably null	Het
Dnah14	A	G	1: 181,426,509 (GRCm39)	R210G	probably benign	Het
Fat4	A	G	3: 38,943,332 (GRCm39)	S742G	possibly damaging	Het
Fbn2	C	T	18: 58,186,099 (GRCm39)	V1750M	probably benign	Het
Glrx2	A	G	1: 143,622,292 (GRCm39)	D96G	probably damaging	Het
Gm8369	T	C	19: 11,489,097 (GRCm39)	L128P	probably damaging	Het
Gpr155	A	G	2: 73,192,780 (GRCm39)	I585T	probably benign	Het
Heatr1	T	C	13: 12,449,140 (GRCm39)	S1907P	probably damaging	Het
Hscb	T	C	5: 110,983,881 (GRCm39)	T129A	possibly damaging	Het
Itgb5	T	A	16: 33,740,335 (GRCm39)	Y482N	probably damaging	Het
Kmt5b	T	A	19: 3,865,587 (GRCm39)	*884R	probably null	Het
L3mbtl1	A	T	2: 162,812,228 (GRCm39)	T758S	possibly damaging	Het
Mindy1	A	T	3: 95,202,176 (GRCm39)	H351L	probably benign	Het
Mmel1	A	T	4: 154,977,285 (GRCm39)	I552F	probably damaging	Het
Mos	T	C	4: 3,871,186 (GRCm39)	D210G	probably benign	Het
Npl	A	C	1: 153,421,030 (GRCm39)	I16S	possibly damaging	Het
Nutm2	C	A	13: 50,629,017 (GRCm39)	P694T	possibly damaging	Het
Or1e1c	G	A	11: 73,265,811 (GRCm39)	V82I	probably damaging	Het
Or52ae7	A	G	7: 103,119,157 (GRCm39)		probably benign	Het
Plekhg4	T	C	8: 106,102,923 (GRCm39)	F261L	probably benign	Het
Ppfia3	T	A	7: 45,005,999 (GRCm39)	N331I	probably benign	Het
Ppp1r12a	T	A	10: 108,096,747 (GRCm39)	S712R	possibly damaging	Het
Psg20	T	A	7: 18,416,508 (GRCm39)	K203*	probably null	Het
Recql	C	T	6: 142,305,646 (GRCm39)	R234Q		Het
Rerg	A	G	6: 137,033,252 (GRCm39)	F160S	probably damaging	Het
Rp1l1	A	G	14: 64,269,126 (GRCm39)	K1571E	probably damaging	Het
Rsrc1	T	A	3: 67,257,328 (GRCm39)	S247T	probably damaging	Het
Sacs	T	A	14: 61,450,881 (GRCm39)	I4309N	possibly damaging	Het
Setd7	A	T	3: 51,450,111 (GRCm39)	I105N	possibly damaging	Het
Sgk1	AAGA	AAGAGA	10: 21,868,290 (GRCm39)		probably null	Het
Siglec1	T	A	2: 130,921,236 (GRCm39)	H645L	probably damaging	Het
Slain1	A	T	14: 103,925,621 (GRCm39)	D323V	probably damaging	Het
Slc25a10	A	G	11: 120,386,312 (GRCm39)	N139D	probably damaging	Het
Slc9a9	T	G	9: 94,552,235 (GRCm39)	F41V	probably damaging	Het
Spag9	A	C	11: 93,988,568 (GRCm39)	E879D	probably damaging	Het
Tdrd7	T	A	4: 46,025,946 (GRCm39)	L922Q	probably damaging	Het
Tiprl	A	G	1: 165,050,147 (GRCm39)	F156S	probably damaging	Het
Tmem185b	G	C	1: 119,454,748 (GRCm39)	V170L	probably damaging	Het
Top2a	G	A	11: 98,887,683 (GRCm39)	T1275I	probably benign	Het
Tpp1	A	G	7: 105,398,104 (GRCm39)	L353P	probably damaging	Het
Twnk	T	A	19: 44,998,622 (GRCm39)	H513Q	probably damaging	Het
Ubr5	C	T	15: 37,978,271 (GRCm39)	V2467I		Het
Vmn2r16	T	A	5: 109,511,677 (GRCm39)	I628N	probably damaging	Het
Zan	T	C	5: 137,462,776 (GRCm39)	E801G	unknown	Het
Zfp810	T	C	9: 22,189,799 (GRCm39)	R370G	possibly damaging	Het
Zfp955a	A	G	17: 33,461,587 (GRCm39)	S182P	probably benign	Het
Znrf3	T	C	11: 5,394,465 (GRCm39)	T72A	possibly damaging	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158,427,889 (GRCm39)	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158,331,883 (GRCm39)	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158,407,897 (GRCm39)	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158,496,201 (GRCm39)	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158,338,724 (GRCm39)	intron	probably benign
IGL02168:Astn1	APN	1	158,436,911 (GRCm39)	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158,491,700 (GRCm39)	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158,338,520 (GRCm39)	splice site	probably benign
IGL02307:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158,329,978 (GRCm39)	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158,332,965 (GRCm39)	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158,516,120 (GRCm39)	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158,439,965 (GRCm39)	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158,496,193 (GRCm39)	splice site	probably benign
IGL03354:Astn1	APN	1	158,516,174 (GRCm39)	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158,424,781 (GRCm39)	missense	probably benign	0.23
PIT4366001:Astn1	UTSW	1	158,424,779 (GRCm39)	missense	probably benign	0.20
R0024:Astn1	UTSW	1	158,511,785 (GRCm39)	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158,407,294 (GRCm39)	splice site	probably benign
R0099:Astn1	UTSW	1	158,329,721 (GRCm39)	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158,516,118 (GRCm39)	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158,337,461 (GRCm39)	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158,427,959 (GRCm39)	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158,299,959 (GRCm39)	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158,337,460 (GRCm39)	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158,338,679 (GRCm39)	nonsense	probably null
R1027:Astn1	UTSW	1	158,407,849 (GRCm39)	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158,427,935 (GRCm39)	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158,329,923 (GRCm39)	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158,407,146 (GRCm39)	splice site	probably benign
R1701:Astn1	UTSW	1	158,331,877 (GRCm39)	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158,331,821 (GRCm39)	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158,429,515 (GRCm39)	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158,332,886 (GRCm39)	splice site	probably null
R1919:Astn1	UTSW	1	158,337,541 (GRCm39)	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158,348,091 (GRCm39)	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158,436,875 (GRCm39)	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158,484,690 (GRCm39)	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158,428,072 (GRCm39)	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158,299,978 (GRCm39)	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158,495,179 (GRCm39)	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158,329,720 (GRCm39)	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158,484,876 (GRCm39)	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158,407,236 (GRCm39)	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158,439,916 (GRCm39)	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158,400,521 (GRCm39)	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158,495,102 (GRCm39)	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158,329,630 (GRCm39)	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158,407,227 (GRCm39)	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158,329,602 (GRCm39)	splice site	probably null
R4625:Astn1	UTSW	1	158,407,864 (GRCm39)	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158,329,821 (GRCm39)	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158,440,102 (GRCm39)	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158,407,933 (GRCm39)	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158,427,950 (GRCm39)	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158,429,507 (GRCm39)	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158,337,563 (GRCm39)	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158,491,691 (GRCm39)	nonsense	probably null
R6481:Astn1	UTSW	1	158,440,032 (GRCm39)	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158,338,718 (GRCm39)	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158,440,042 (GRCm39)	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158,491,644 (GRCm39)	nonsense	probably null
R7062:Astn1	UTSW	1	158,516,081 (GRCm39)	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158,400,557 (GRCm39)	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158,491,846 (GRCm39)	splice site	probably null
R7402:Astn1	UTSW	1	158,380,425 (GRCm39)	intron	probably benign
R7412:Astn1	UTSW	1	158,329,919 (GRCm39)	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158,438,352 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,495,208 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,332,956 (GRCm39)	missense	possibly damaging	0.84
R7635:Astn1	UTSW	1	158,495,105 (GRCm39)	nonsense	probably null
R7890:Astn1	UTSW	1	158,407,903 (GRCm39)	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158,429,508 (GRCm39)	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158,424,886 (GRCm39)	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158,516,208 (GRCm39)	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158,331,920 (GRCm39)	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158,436,890 (GRCm39)	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158,436,850 (GRCm39)	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158,329,803 (GRCm39)	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158,484,670 (GRCm39)	missense	probably benign	0.09
R8983:Astn1	UTSW	1	158,491,700 (GRCm39)	critical splice donor site	probably null
R9013:Astn1	UTSW	1	158,348,070 (GRCm39)	missense	probably damaging	1.00
R9110:Astn1	UTSW	1	158,496,327 (GRCm39)	missense	probably benign	0.01
R9156:Astn1	UTSW	1	158,338,555 (GRCm39)	missense	probably damaging	0.99
R9355:Astn1	UTSW	1	158,511,721 (GRCm39)	missense	probably damaging	1.00
Z1088:Astn1	UTSW	1	158,511,666 (GRCm39)	nonsense	probably null
Z1088:Astn1	UTSW	1	158,424,776 (GRCm39)	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158,300,067 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ACAGTCTTTTCTCTGAAGGTGG -3'
(R):5'- AACAGCTTGTGTGCCTGCTC -3'

Sequencing Primer
(F):5'- TCTCTGAAGGTGGTCTAGGAC -3'
(R):5'- TACCGAAAGTTCCTGATAGCAG -3'

Posted On

2022-10-06