Incidental Mutation 'R9683:Dnah14'
ID 728665
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms Dnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 181576559-181815774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181598944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 210 (R210G)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: R210G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C T 3: 124,406,446 G499D probably benign Het
Acr T A 15: 89,573,237 Y229* probably null Het
Adam6b G T 12: 113,490,556 C331F probably benign Het
Ahnak T C 19: 9,007,355 V2001A possibly damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
Anln A T 9: 22,372,240 C432* probably null Het
Aox4 T C 1: 58,239,303 probably null Het
Astn1 A G 1: 158,664,049 I1007V possibly damaging Het
Bicral T C 17: 46,812,018 D649G possibly damaging Het
C1qbp G A 11: 70,982,923 R10C probably damaging Het
Cass4 C T 2: 172,426,736 P246L probably damaging Het
Celsr3 T A 9: 108,827,323 V335E probably damaging Het
Cfap52 T A 11: 67,931,813 T411S probably benign Het
Cnot6 A T 11: 49,689,337 L43I possibly damaging Het
Col9a3 G A 2: 180,606,529 probably null Het
Fat4 A G 3: 38,889,183 S742G possibly damaging Het
Fbn2 C T 18: 58,053,027 V1750M probably benign Het
Glrx2 A G 1: 143,746,554 D96G probably damaging Het
Gm8369 T C 19: 11,511,733 L128P probably damaging Het
Gpr155 A G 2: 73,362,436 I585T probably benign Het
Heatr1 T C 13: 12,434,259 S1907P probably damaging Het
Hscb T C 5: 110,836,015 T129A possibly damaging Het
Itgb5 T A 16: 33,919,965 Y482N probably damaging Het
Kmt5b T A 19: 3,815,587 *884R probably null Het
L3mbtl1 A T 2: 162,970,308 T758S possibly damaging Het
Mindy1 A T 3: 95,294,865 H351L probably benign Het
Mmel1 A T 4: 154,892,828 I552F probably damaging Het
Mos T C 4: 3,871,186 D210G probably benign Het
Npl A C 1: 153,545,284 I16S possibly damaging Het
Nutm2 C A 13: 50,474,981 P694T possibly damaging Het
Olfr376 G A 11: 73,374,985 V82I probably damaging Het
Olfr608 A G 7: 103,469,950 probably benign Het
Plekhg4 T C 8: 105,376,291 F261L probably benign Het
Ppfia3 T A 7: 45,356,575 N331I probably benign Het
Ppp1r12a T A 10: 108,260,886 S712R possibly damaging Het
Psg20 T A 7: 18,682,583 K203* probably null Het
Recql C T 6: 142,359,920 R234Q Het
Rerg A G 6: 137,056,254 F160S probably damaging Het
Rp1l1 A G 14: 64,031,677 K1571E probably damaging Het
Rsrc1 T A 3: 67,349,995 S247T probably damaging Het
Sacs T A 14: 61,213,432 I4309N possibly damaging Het
Setd7 A T 3: 51,542,690 I105N possibly damaging Het
Sgk1 AAGA AAGAGA 10: 21,992,391 probably null Het
Siglec1 T A 2: 131,079,316 H645L probably damaging Het
Slain1 A T 14: 103,688,185 D323V probably damaging Het
Slc25a10 A G 11: 120,495,486 N139D probably damaging Het
Slc9a9 T G 9: 94,670,182 F41V probably damaging Het
Spag9 A C 11: 94,097,742 E879D probably damaging Het
Tdrd7 T A 4: 46,025,946 L922Q probably damaging Het
Tiprl A G 1: 165,222,578 F156S probably damaging Het
Tmem185b G C 1: 119,527,018 V170L probably damaging Het
Top2a G A 11: 98,996,857 T1275I probably benign Het
Tpp1 A G 7: 105,748,897 L353P probably damaging Het
Twnk T A 19: 45,010,183 H513Q probably damaging Het
Ubr5 C T 15: 37,978,027 V2467I Het
Vmn2r16 T A 5: 109,363,811 I628N probably damaging Het
Zan T C 5: 137,464,514 E801G unknown Het
Zfp810 T C 9: 22,278,503 R370G possibly damaging Het
Zfp955a A G 17: 33,242,613 S182P probably benign Het
Znrf3 T C 11: 5,444,465 T72A possibly damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
R8520:Dnah14 UTSW 1 181653638 missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181664946 missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181666011 nonsense probably null
R8710:Dnah14 UTSW 1 181690311 missense probably benign 0.04
R8752:Dnah14 UTSW 1 181628016 missense probably benign 0.00
R8792:Dnah14 UTSW 1 181814624 missense
R8797:Dnah14 UTSW 1 181637847 missense probably benign 0.19
R8821:Dnah14 UTSW 1 181792004 nonsense probably null
R8834:Dnah14 UTSW 1 181616750 missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181725498 missense probably benign 0.01
R8925:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181622723 missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9169:Dnah14 UTSW 1 181605816 missense probably benign 0.06
R9199:Dnah14 UTSW 1 181651001 missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181801287 missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181616640 critical splice donor site probably null
R9271:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9282:Dnah14 UTSW 1 181814512 missense
R9350:Dnah14 UTSW 1 181734804 missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181709033 missense probably benign 0.01
R9436:Dnah14 UTSW 1 181680783 missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181690208 missense probably benign 0.45
R9484:Dnah14 UTSW 1 181797746 missense probably benign 0.01
R9486:Dnah14 UTSW 1 181680929 missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181674442 missense probably benign 0.16
R9654:Dnah14 UTSW 1 181766339 missense probably benign 0.01
R9681:Dnah14 UTSW 1 181734849 missense possibly damaging 0.91
R9687:Dnah14 UTSW 1 181598413 missense probably benign 0.01
R9718:Dnah14 UTSW 1 181622979 missense probably benign 0.08
R9751:Dnah14 UTSW 1 181792045 missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181685784 missense probably benign 0.03
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAATGGAATGACTGTTGCTTAC -3'
(R):5'- TGTCCAATGTATTCAGAATACCAGC -3'

Sequencing Primer
(F):5'- GAATGACTGTTGCTTACATTTGCC -3'
(R):5'- CCAGCATAATGTGACTTCCCAATGTG -3'
Posted On 2022-10-06