Incidental Mutation 'R9683:1700006A11Rik'
ID 728675
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene Name RIKEN cDNA 1700006A11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 124400989-124426040 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124406446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 499 (G499D)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
AlphaFold B9EHI3
Predicted Effect probably benign
Transcript: ENSMUST00000029598
AA Change: G499D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: G499D

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr T A 15: 89,573,237 Y229* probably null Het
Adam6b G T 12: 113,490,556 C331F probably benign Het
Ahnak T C 19: 9,007,355 V2001A possibly damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
Anln A T 9: 22,372,240 C432* probably null Het
Aox4 T C 1: 58,239,303 probably null Het
Astn1 A G 1: 158,664,049 I1007V possibly damaging Het
Bicral T C 17: 46,812,018 D649G possibly damaging Het
C1qbp G A 11: 70,982,923 R10C probably damaging Het
Cass4 C T 2: 172,426,736 P246L probably damaging Het
Celsr3 T A 9: 108,827,323 V335E probably damaging Het
Cfap52 T A 11: 67,931,813 T411S probably benign Het
Cnot6 A T 11: 49,689,337 L43I possibly damaging Het
Col9a3 G A 2: 180,606,529 probably null Het
Dnah14 A G 1: 181,598,944 R210G probably benign Het
Fat4 A G 3: 38,889,183 S742G possibly damaging Het
Fbn2 C T 18: 58,053,027 V1750M probably benign Het
Glrx2 A G 1: 143,746,554 D96G probably damaging Het
Gm8369 T C 19: 11,511,733 L128P probably damaging Het
Gpr155 A G 2: 73,362,436 I585T probably benign Het
Heatr1 T C 13: 12,434,259 S1907P probably damaging Het
Hscb T C 5: 110,836,015 T129A possibly damaging Het
Itgb5 T A 16: 33,919,965 Y482N probably damaging Het
Kmt5b T A 19: 3,815,587 *884R probably null Het
L3mbtl1 A T 2: 162,970,308 T758S possibly damaging Het
Mindy1 A T 3: 95,294,865 H351L probably benign Het
Mmel1 A T 4: 154,892,828 I552F probably damaging Het
Mos T C 4: 3,871,186 D210G probably benign Het
Npl A C 1: 153,545,284 I16S possibly damaging Het
Nutm2 C A 13: 50,474,981 P694T possibly damaging Het
Olfr376 G A 11: 73,374,985 V82I probably damaging Het
Olfr608 A G 7: 103,469,950 probably benign Het
Plekhg4 T C 8: 105,376,291 F261L probably benign Het
Ppfia3 T A 7: 45,356,575 N331I probably benign Het
Ppp1r12a T A 10: 108,260,886 S712R possibly damaging Het
Psg20 T A 7: 18,682,583 K203* probably null Het
Recql C T 6: 142,359,920 R234Q Het
Rerg A G 6: 137,056,254 F160S probably damaging Het
Rp1l1 A G 14: 64,031,677 K1571E probably damaging Het
Rsrc1 T A 3: 67,349,995 S247T probably damaging Het
Sacs T A 14: 61,213,432 I4309N possibly damaging Het
Setd7 A T 3: 51,542,690 I105N possibly damaging Het
Sgk1 AAGA AAGAGA 10: 21,992,391 probably null Het
Siglec1 T A 2: 131,079,316 H645L probably damaging Het
Slain1 A T 14: 103,688,185 D323V probably damaging Het
Slc25a10 A G 11: 120,495,486 N139D probably damaging Het
Slc9a9 T G 9: 94,670,182 F41V probably damaging Het
Spag9 A C 11: 94,097,742 E879D probably damaging Het
Tdrd7 T A 4: 46,025,946 L922Q probably damaging Het
Tiprl A G 1: 165,222,578 F156S probably damaging Het
Tmem185b G C 1: 119,527,018 V170L probably damaging Het
Top2a G A 11: 98,996,857 T1275I probably benign Het
Tpp1 A G 7: 105,748,897 L353P probably damaging Het
Twnk T A 19: 45,010,183 H513Q probably damaging Het
Ubr5 C T 15: 37,978,027 V2467I Het
Vmn2r16 T A 5: 109,363,811 I628N probably damaging Het
Zan T C 5: 137,464,514 E801G unknown Het
Zfp810 T C 9: 22,278,503 R370G possibly damaging Het
Zfp955a A G 17: 33,242,613 S182P probably benign Het
Znrf3 T C 11: 5,444,465 T72A possibly damaging Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124401409 missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124414496 missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124406470 missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124409778 splice site probably benign
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124419250 missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124413634 missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124414406 missense possibly damaging 0.95
R1549:1700006A11Rik UTSW 3 124416792 missense probably benign 0.00
R1779:1700006A11Rik UTSW 3 124406514 missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124409720 missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124419328 missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124416728 splice site probably benign
R2149:1700006A11Rik UTSW 3 124409686 missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124413618 missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124413801 missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124406453 missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124419856 missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124416833 missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124421428 missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124416799 missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124416850 splice site probably null
R6504:1700006A11Rik UTSW 3 124419920 missense probably benign
R7124:1700006A11Rik UTSW 3 124414393 missense probably benign 0.04
R7248:1700006A11Rik UTSW 3 124414310 critical splice donor site probably null
R7351:1700006A11Rik UTSW 3 124412510 missense probably damaging 1.00
R7709:1700006A11Rik UTSW 3 124407685 missense probably damaging 1.00
R7773:1700006A11Rik UTSW 3 124412531 missense probably benign 0.00
R8193:1700006A11Rik UTSW 3 124419868 missense possibly damaging 0.84
R8201:1700006A11Rik UTSW 3 124401397 missense probably benign 0.00
R9157:1700006A11Rik UTSW 3 124413571 missense probably benign 0.22
R9313:1700006A11Rik UTSW 3 124413571 missense probably benign 0.22
R9585:1700006A11Rik UTSW 3 124406344 missense possibly damaging 0.73
R9721:1700006A11Rik UTSW 3 124419283 missense probably benign 0.00
X0063:1700006A11Rik UTSW 3 124419862 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTCAAAGGTGTCCCCAG -3'
(R):5'- GCCAGTGGATTGCTACAATGTG -3'

Sequencing Primer
(F):5'- TCATTCCCAAACCCTGAG -3'
(R):5'- GGCACCAGGCTCATGTAGTATAC -3'
Posted On 2022-10-06