Mutagenetix > Incidental Mutation

Incidental Mutation 'R9683:Heatr1'

728705

Institutional Source

Beutler Lab

Gene Symbol

Heatr1

Ensembl Gene

ENSMUSG00000050244

Gene Name

HEAT repeat containing 1

Synonyms

B130016L12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R9683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12395027-12440289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12434259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1907 (S1907P)

Ref Sequence

ENSEMBL: ENSMUSP00000054084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059270]

AlphaFold

G3X9B1

Predicted Effect

probably damaging
Transcript: ENSMUST00000059270
AA Change: S1907P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: S1907P

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Pfam:U3snoRNP10	238	354	7e-30	PFAM
SCOP:d1qbkb_	919	1795	3e-8	SMART
low complexity region	1805	1814	N/A	INTRINSIC
BP28CT	1856	2009	2.25e-77	SMART
Blast:BP28CT	2015	2061	2e-15	BLAST
coiled coil region	2109	2137	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	T	3: 124,406,446	G499D	probably benign	Het
Acr	T	A	15: 89,573,237	Y229*	probably null	Het
Adam6b	G	T	12: 113,490,556	C331F	probably benign	Het
Ahnak	T	C	19: 9,007,355	V2001A	possibly damaging	Het
Ankrd11	C	T	8: 122,890,943	A2057T	probably benign	Het
Anln	A	T	9: 22,372,240	C432*	probably null	Het
Aox4	T	C	1: 58,239,303		probably null	Het
Astn1	A	G	1: 158,664,049	I1007V	possibly damaging	Het
Bicral	T	C	17: 46,812,018	D649G	possibly damaging	Het
C1qbp	G	A	11: 70,982,923	R10C	probably damaging	Het
Cass4	C	T	2: 172,426,736	P246L	probably damaging	Het
Celsr3	T	A	9: 108,827,323	V335E	probably damaging	Het
Cfap52	T	A	11: 67,931,813	T411S	probably benign	Het
Cnot6	A	T	11: 49,689,337	L43I	possibly damaging	Het
Col9a3	G	A	2: 180,606,529		probably null	Het
Dnah14	A	G	1: 181,598,944	R210G	probably benign	Het
Fat4	A	G	3: 38,889,183	S742G	possibly damaging	Het
Fbn2	C	T	18: 58,053,027	V1750M	probably benign	Het
Glrx2	A	G	1: 143,746,554	D96G	probably damaging	Het
Gm8369	T	C	19: 11,511,733	L128P	probably damaging	Het
Gpr155	A	G	2: 73,362,436	I585T	probably benign	Het
Hscb	T	C	5: 110,836,015	T129A	possibly damaging	Het
Itgb5	T	A	16: 33,919,965	Y482N	probably damaging	Het
Kmt5b	T	A	19: 3,815,587	*884R	probably null	Het
L3mbtl1	A	T	2: 162,970,308	T758S	possibly damaging	Het
Mindy1	A	T	3: 95,294,865	H351L	probably benign	Het
Mmel1	A	T	4: 154,892,828	I552F	probably damaging	Het
Mos	T	C	4: 3,871,186	D210G	probably benign	Het
Npl	A	C	1: 153,545,284	I16S	possibly damaging	Het
Nutm2	C	A	13: 50,474,981	P694T	possibly damaging	Het
Olfr376	G	A	11: 73,374,985	V82I	probably damaging	Het
Olfr608	A	G	7: 103,469,950		probably benign	Het
Plekhg4	T	C	8: 105,376,291	F261L	probably benign	Het
Ppfia3	T	A	7: 45,356,575	N331I	probably benign	Het
Ppp1r12a	T	A	10: 108,260,886	S712R	possibly damaging	Het
Psg20	T	A	7: 18,682,583	K203*	probably null	Het
Recql	C	T	6: 142,359,920	R234Q		Het
Rerg	A	G	6: 137,056,254	F160S	probably damaging	Het
Rp1l1	A	G	14: 64,031,677	K1571E	probably damaging	Het
Rsrc1	T	A	3: 67,349,995	S247T	probably damaging	Het
Sacs	T	A	14: 61,213,432	I4309N	possibly damaging	Het
Setd7	A	T	3: 51,542,690	I105N	possibly damaging	Het
Sgk1	AAGA	AAGAGA	10: 21,992,391		probably null	Het
Siglec1	T	A	2: 131,079,316	H645L	probably damaging	Het
Slain1	A	T	14: 103,688,185	D323V	probably damaging	Het
Slc25a10	A	G	11: 120,495,486	N139D	probably damaging	Het
Slc9a9	T	G	9: 94,670,182	F41V	probably damaging	Het
Spag9	A	C	11: 94,097,742	E879D	probably damaging	Het
Tdrd7	T	A	4: 46,025,946	L922Q	probably damaging	Het
Tiprl	A	G	1: 165,222,578	F156S	probably damaging	Het
Tmem185b	G	C	1: 119,527,018	V170L	probably damaging	Het
Top2a	G	A	11: 98,996,857	T1275I	probably benign	Het
Tpp1	A	G	7: 105,748,897	L353P	probably damaging	Het
Twnk	T	A	19: 45,010,183	H513Q	probably damaging	Het
Ubr5	C	T	15: 37,978,027	V2467I		Het
Vmn2r16	T	A	5: 109,363,811	I628N	probably damaging	Het
Zan	T	C	5: 137,464,514	E801G	unknown	Het
Zfp810	T	C	9: 22,278,503	R370G	possibly damaging	Het
Zfp955a	A	G	17: 33,242,613	S182P	probably benign	Het
Znrf3	T	C	11: 5,444,465	T72A	possibly damaging	Het

Other mutations in Heatr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Heatr1	APN	13	12410450	missense	probably benign	0.00
IGL00863:Heatr1	APN	13	12435128	missense	probably benign	0.02
IGL00899:Heatr1	APN	13	12435176	missense	probably benign	0.31
IGL01147:Heatr1	APN	13	12437912	missense	probably damaging	0.99
IGL01317:Heatr1	APN	13	12399027	missense	probably damaging	1.00
IGL01323:Heatr1	APN	13	12398938	missense	possibly damaging	0.86
IGL01625:Heatr1	APN	13	12413528	missense	probably damaging	0.98
IGL01973:Heatr1	APN	13	12429799	missense	probably benign
IGL02803:Heatr1	APN	13	12433986	missense	probably damaging	0.96
IGL02830:Heatr1	APN	13	12426212	missense	possibly damaging	0.57
IGL02956:Heatr1	APN	13	12416059	missense	possibly damaging	0.53
IGL03000:Heatr1	APN	13	12434411	missense	probably damaging	0.99
IGL03024:Heatr1	APN	13	12407509	unclassified	probably benign
IGL03035:Heatr1	APN	13	12413219	splice site	probably benign
IGL03301:Heatr1	APN	13	12434205	missense	probably damaging	1.00
hasan	UTSW	13	12417447	splice site	probably benign
H8562:Heatr1	UTSW	13	12408713	missense	probably benign	0.13
R0226:Heatr1	UTSW	13	12410562	missense	probably damaging	1.00
R0571:Heatr1	UTSW	13	12430240	missense	probably damaging	0.98
R0722:Heatr1	UTSW	13	12406037	missense	probably benign	0.14
R1264:Heatr1	UTSW	13	12424610	unclassified	probably benign
R1371:Heatr1	UTSW	13	12417632	missense	possibly damaging	0.80
R1388:Heatr1	UTSW	13	12417447	splice site	probably benign
R1396:Heatr1	UTSW	13	12406046	missense	possibly damaging	0.86
R1519:Heatr1	UTSW	13	12412159	missense	probably benign
R1689:Heatr1	UTSW	13	12424625	missense	probably benign	0.00
R1696:Heatr1	UTSW	13	12423721	missense	possibly damaging	0.96
R1756:Heatr1	UTSW	13	12396460	missense	probably benign	0.01
R1859:Heatr1	UTSW	13	12403159	missense	probably damaging	1.00
R1932:Heatr1	UTSW	13	12435185	missense	probably damaging	1.00
R1957:Heatr1	UTSW	13	12396538	missense	probably damaging	1.00
R2018:Heatr1	UTSW	13	12414478	missense	possibly damaging	0.68
R2106:Heatr1	UTSW	13	12412058	missense	probably benign	0.03
R2119:Heatr1	UTSW	13	12432646	missense	probably null	1.00
R2121:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2122:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2367:Heatr1	UTSW	13	12433724	missense	probably damaging	1.00
R3777:Heatr1	UTSW	13	12413348	missense	possibly damaging	0.92
R3783:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3784:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3786:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3787:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3843:Heatr1	UTSW	13	12435121	missense	probably benign	0.00
R4533:Heatr1	UTSW	13	12434511	missense	probably benign	0.05
R4725:Heatr1	UTSW	13	12424662	nonsense	probably null
R4763:Heatr1	UTSW	13	12430930	missense	possibly damaging	0.65
R4793:Heatr1	UTSW	13	12431837	missense	probably benign	0.00
R4797:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4798:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4942:Heatr1	UTSW	13	12413510	critical splice acceptor site	probably null
R4952:Heatr1	UTSW	13	12410599	missense	probably benign	0.38
R4954:Heatr1	UTSW	13	12407516	critical splice acceptor site	probably null
R5370:Heatr1	UTSW	13	12401522	missense	probably benign	0.02
R5464:Heatr1	UTSW	13	12433643	missense	probably benign	0.00
R5483:Heatr1	UTSW	13	12398914	missense	probably damaging	1.00
R5497:Heatr1	UTSW	13	12421064	missense	possibly damaging	0.93
R5504:Heatr1	UTSW	13	12406619	missense	possibly damaging	0.64
R5527:Heatr1	UTSW	13	12402760	missense	probably damaging	1.00
R5527:Heatr1	UTSW	13	12404948	missense	probably benign
R5836:Heatr1	UTSW	13	12408736	missense	probably damaging	0.99
R5916:Heatr1	UTSW	13	12434471	missense	probably damaging	1.00
R6018:Heatr1	UTSW	13	12404947	missense	probably benign
R6018:Heatr1	UTSW	13	12406058	missense	probably benign	0.26
R6216:Heatr1	UTSW	13	12432664	missense	probably benign	0.16
R6396:Heatr1	UTSW	13	12406097	missense	possibly damaging	0.86
R6472:Heatr1	UTSW	13	12434230	missense	probably benign	0.29
R6922:Heatr1	UTSW	13	12435075	missense	probably benign	0.00
R7077:Heatr1	UTSW	13	12418164	missense	possibly damaging	0.63
R7297:Heatr1	UTSW	13	12421060	nonsense	probably null
R7445:Heatr1	UTSW	13	12431038	missense	possibly damaging	0.70
R7669:Heatr1	UTSW	13	12411262	missense	probably benign	0.33
R7672:Heatr1	UTSW	13	12438664	missense	probably damaging	0.96
R7772:Heatr1	UTSW	13	12417641	missense	probably benign	0.03
R8205:Heatr1	UTSW	13	12416047	missense	probably benign
R8518:Heatr1	UTSW	13	12410534	missense	probably benign
R8754:Heatr1	UTSW	13	12413294	missense	probably damaging	0.99
R8874:Heatr1	UTSW	13	12430912	missense	probably damaging	1.00
R8992:Heatr1	UTSW	13	12401114	missense	probably damaging	0.98
R9045:Heatr1	UTSW	13	12413352	missense	probably benign	0.00
R9077:Heatr1	UTSW	13	12413366	missense	probably benign
R9183:Heatr1	UTSW	13	12421385	missense	probably damaging	0.99
R9186:Heatr1	UTSW	13	12421346	missense	probably damaging	1.00
R9223:Heatr1	UTSW	13	12404921	missense	probably benign	0.00
R9242:Heatr1	UTSW	13	12433925	missense	probably benign
R9267:Heatr1	UTSW	13	12406608	missense	probably damaging	1.00
R9289:Heatr1	UTSW	13	12432727	missense	probably benign	0.13
R9310:Heatr1	UTSW	13	12438610	missense	probably benign
R9312:Heatr1	UTSW	13	12431684	missense	probably benign
R9358:Heatr1	UTSW	13	12418206	missense	probably benign	0.09
R9385:Heatr1	UTSW	13	12406542	missense	probably damaging	1.00
R9530:Heatr1	UTSW	13	12424726	missense	probably damaging	1.00
R9532:Heatr1	UTSW	13	12414425	missense	possibly damaging	0.72
R9647:Heatr1	UTSW	13	12426798	missense	probably benign	0.00
R9695:Heatr1	UTSW	13	12423743	missense	probably damaging	1.00
RF011:Heatr1	UTSW	13	12407544	missense	probably benign	0.00
Z1176:Heatr1	UTSW	13	12399008	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CCTATCTGTGCAAGAGCCAG -3'
(R):5'- AAGGTTTCACCAAGTGGCC -3'

Sequencing Primer
(F):5'- GTGCAAGAGCCAGATTAATTTTTAAC -3'
(R):5'- TTCTCAGCAATGCAGTCAGC -3'

Posted On

2022-10-06