Mutagenetix > Incidental Mutation

Incidental Mutation 'R9683:Ubr5'

728710

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 37978027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 2467 (V2467I)

Ref Sequence

ENSEMBL: ENSMUSP00000105965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414] [ENSMUST00000228333]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: V2467I

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226414
AA Change: V2473I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000228333
AA Change: V30I

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	T	3: 124,406,446	G499D	probably benign	Het
Acr	T	A	15: 89,573,237	Y229*	probably null	Het
Adam6b	G	T	12: 113,490,556	C331F	probably benign	Het
Ahnak	T	C	19: 9,007,355	V2001A	possibly damaging	Het
Ankrd11	C	T	8: 122,890,943	A2057T	probably benign	Het
Anln	A	T	9: 22,372,240	C432*	probably null	Het
Aox4	T	C	1: 58,239,303		probably null	Het
Astn1	A	G	1: 158,664,049	I1007V	possibly damaging	Het
Bicral	T	C	17: 46,812,018	D649G	possibly damaging	Het
C1qbp	G	A	11: 70,982,923	R10C	probably damaging	Het
Cass4	C	T	2: 172,426,736	P246L	probably damaging	Het
Celsr3	T	A	9: 108,827,323	V335E	probably damaging	Het
Cfap52	T	A	11: 67,931,813	T411S	probably benign	Het
Cnot6	A	T	11: 49,689,337	L43I	possibly damaging	Het
Col9a3	G	A	2: 180,606,529		probably null	Het
Dnah14	A	G	1: 181,598,944	R210G	probably benign	Het
Fat4	A	G	3: 38,889,183	S742G	possibly damaging	Het
Fbn2	C	T	18: 58,053,027	V1750M	probably benign	Het
Glrx2	A	G	1: 143,746,554	D96G	probably damaging	Het
Gm8369	T	C	19: 11,511,733	L128P	probably damaging	Het
Gpr155	A	G	2: 73,362,436	I585T	probably benign	Het
Heatr1	T	C	13: 12,434,259	S1907P	probably damaging	Het
Hscb	T	C	5: 110,836,015	T129A	possibly damaging	Het
Itgb5	T	A	16: 33,919,965	Y482N	probably damaging	Het
Kmt5b	T	A	19: 3,815,587	*884R	probably null	Het
L3mbtl1	A	T	2: 162,970,308	T758S	possibly damaging	Het
Mindy1	A	T	3: 95,294,865	H351L	probably benign	Het
Mmel1	A	T	4: 154,892,828	I552F	probably damaging	Het
Mos	T	C	4: 3,871,186	D210G	probably benign	Het
Npl	A	C	1: 153,545,284	I16S	possibly damaging	Het
Nutm2	C	A	13: 50,474,981	P694T	possibly damaging	Het
Olfr376	G	A	11: 73,374,985	V82I	probably damaging	Het
Olfr608	A	G	7: 103,469,950		probably benign	Het
Plekhg4	T	C	8: 105,376,291	F261L	probably benign	Het
Ppfia3	T	A	7: 45,356,575	N331I	probably benign	Het
Ppp1r12a	T	A	10: 108,260,886	S712R	possibly damaging	Het
Psg20	T	A	7: 18,682,583	K203*	probably null	Het
Recql	C	T	6: 142,359,920	R234Q		Het
Rerg	A	G	6: 137,056,254	F160S	probably damaging	Het
Rp1l1	A	G	14: 64,031,677	K1571E	probably damaging	Het
Rsrc1	T	A	3: 67,349,995	S247T	probably damaging	Het
Sacs	T	A	14: 61,213,432	I4309N	possibly damaging	Het
Setd7	A	T	3: 51,542,690	I105N	possibly damaging	Het
Sgk1	AAGA	AAGAGA	10: 21,992,391		probably null	Het
Siglec1	T	A	2: 131,079,316	H645L	probably damaging	Het
Slain1	A	T	14: 103,688,185	D323V	probably damaging	Het
Slc25a10	A	G	11: 120,495,486	N139D	probably damaging	Het
Slc9a9	T	G	9: 94,670,182	F41V	probably damaging	Het
Spag9	A	C	11: 94,097,742	E879D	probably damaging	Het
Tdrd7	T	A	4: 46,025,946	L922Q	probably damaging	Het
Tiprl	A	G	1: 165,222,578	F156S	probably damaging	Het
Tmem185b	G	C	1: 119,527,018	V170L	probably damaging	Het
Top2a	G	A	11: 98,996,857	T1275I	probably benign	Het
Tpp1	A	G	7: 105,748,897	L353P	probably damaging	Het
Twnk	T	A	19: 45,010,183	H513Q	probably damaging	Het
Vmn2r16	T	A	5: 109,363,811	I628N	probably damaging	Het
Zan	T	C	5: 137,464,514	E801G	unknown	Het
Zfp810	T	C	9: 22,278,503	R370G	possibly damaging	Het
Zfp955a	A	G	17: 33,242,613	S182P	probably benign	Het
Znrf3	T	C	11: 5,444,465	T72A	possibly damaging	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
Anchovy	UTSW	15	37979832	missense	probably null
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R8191:Ubr5	UTSW	15	38006507	missense
R8342:Ubr5	UTSW	15	38024837	missense
R8745:Ubr5	UTSW	15	38024795	missense
R8811:Ubr5	UTSW	15	38040879	missense
R8904:Ubr5	UTSW	15	38041909	missense
R8955:Ubr5	UTSW	15	38029581	missense
R8956:Ubr5	UTSW	15	38015123	missense	probably damaging	1.00
R9051:Ubr5	UTSW	15	38002259	missense
R9102:Ubr5	UTSW	15	38018352	missense
R9183:Ubr5	UTSW	15	37997176	missense
R9235:Ubr5	UTSW	15	38045738	missense
R9392:Ubr5	UTSW	15	37984007	missense
R9473:Ubr5	UTSW	15	38002373	missense
R9596:Ubr5	UTSW	15	37985969	missense
R9659:Ubr5	UTSW	15	37984010	missense
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- GGATCTCTACCGCTCAATTCAG -3'
(R):5'- GGAGCCTTTGCCATGTCTTG -3'

Sequencing Primer
(F):5'- ACCGCTCAATTCAGTCTGTTCAAAC -3'
(R):5'- AAACAGTGTCCTTGCCAGTG -3'

Posted On

2022-10-06