Mutagenetix > Incidental Mutation

Incidental Mutation 'R9685:Arhgef5'

728794

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9685 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 43273593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 426 (I426S)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably benign
Transcript: ENSMUST00000031750
AA Change: I426S

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: I426S

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930453N24Rik	G	T	16: 64,766,460	N300K	possibly damaging	Het
A130010J15Rik	G	A	1: 193,174,757	R139H	probably benign	Het
Aanat	A	C	11: 116,596,855	T127P	possibly damaging	Het
Acp4	G	A	7: 44,257,309		probably benign	Het
Bcl2a1a	T	C	9: 88,957,132	S28P	probably benign	Het
Cd163	T	C	6: 124,311,425	S272P	possibly damaging	Het
Cdk13	C	A	13: 17,803,957	R232L	unknown	Het
Clrn2	A	G	5: 45,453,989	D60G	possibly damaging	Het
Cnot6l	A	G	5: 96,082,890	L406P	probably damaging	Het
Cspg4	T	G	9: 56,890,338	V1362G	probably benign	Het
Cspp1	C	T	1: 10,126,414	S939L	probably benign	Het
Dcaf1	C	T	9: 106,836,619	T145I	probably benign	Het
Ddx28	T	C	8: 106,010,101	S442G	probably benign	Het
Dnajc3	A	T	14: 118,972,363	R283S	probably benign	Het
Dsc1	G	A	18: 20,099,030	T307I	possibly damaging	Het
Elovl5	T	C	9: 77,961,009	Y68H	probably damaging	Het
Fam25c	G	A	14: 34,355,309	T17I	probably damaging	Het
Fryl	T	C	5: 73,059,536	E2137G	probably damaging	Het
Gm10142	A	G	10: 77,715,928	Q41R	unknown	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Grm1	T	C	10: 10,689,031	T1178A	possibly damaging	Het
Hhip	A	T	8: 79,996,734	H430Q	probably damaging	Het
Hip1	A	G	5: 135,449,822	F178L	probably damaging	Het
Impa1	T	A	3: 10,328,370	I58L	probably benign	Het
Irak4	T	A	15: 94,553,931	V135E	probably benign	Het
Jup	A	C	11: 100,383,411	L151R	probably damaging	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Mapkbp1	C	A	2: 120,021,183	R863S	probably benign	Het
Olfr1008	T	C	2: 85,689,522	F31S	probably damaging	Het
Pramef17	T	A	4: 143,992,950	M282L	probably benign	Het
Rasa4	A	G	5: 136,095,529	D144G	probably benign	Het
Rrs1	T	A	1: 9,546,165	S214R	probably benign	Het
Rsf1	CGGC	CGGCGGCGGGGGC	7: 97,579,932		probably benign	Het
Rtca	T	A	3: 116,499,576	R195S	probably benign	Het
Scaper	A	T	9: 55,864,551	S360R	probably benign	Het
Scarb1	A	T	5: 125,294,130	F293I	possibly damaging	Het
Snapc1	T	C	12: 73,970,341		probably null	Het
Spta1	T	C	1: 174,205,359	V994A	probably damaging	Het
Synpo2	T	C	3: 123,117,717	E93G	probably damaging	Het
Ubr4	A	G	4: 139,464,030	T985A	unknown	Het
Vmn1r18	T	C	6: 57,390,478	I30M	possibly damaging	Het
Vmn2r15	A	G	5: 109,292,732	V420A	probably benign	Het
Vmn2r6	A	G	3: 64,556,660	V251A	probably benign	Het
Zfyve16	A	T	13: 92,522,803	I200N	possibly damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCAAACAGGAAAAGTGATGCCC -3'
(R):5'- GGAGCCACAGATGTACTAGC -3'

Sequencing Primer
(F):5'- CAGGAAAAGTGATGCCCGTAAG -3'
(R):5'- GCCACAGATGTACTAGCAGAGAC -3'

Posted On

2022-10-06