Incidental Mutation 'R9685:Scaper'
ID 728801
Institutional Source Beutler Lab
Gene Symbol Scaper
Ensembl Gene ENSMUSG00000034007
Gene Name S phase cyclin A-associated protein in the ER
Synonyms Zfp291, D530014O03Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.629) question?
Stock # R9685 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 55457163-55845403 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55771835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 360 (S360R)
Ref Sequence ENSEMBL: ENSMUSP00000043411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]
AlphaFold F8VQ70
Predicted Effect probably benign
Transcript: ENSMUST00000037408
AA Change: S360R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: S360R

DomainStartEndE-ValueType
Pfam:SCAPER_N 88 185 3.4e-47 PFAM
low complexity region 323 338 N/A INTRINSIC
coiled coil region 415 466 N/A INTRINSIC
coiled coil region 535 597 N/A INTRINSIC
SCOP:d1eq1a_ 605 769 3e-6 SMART
ZnF_C2H2 791 815 1.16e1 SMART
low complexity region 866 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214747
AA Change: S360R

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216595
Predicted Effect probably benign
Transcript: ENSMUST00000217647
AA Change: S360R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik G T 16: 64,586,823 (GRCm39) N300K possibly damaging Het
A130010J15Rik G A 1: 192,857,065 (GRCm39) R139H probably benign Het
Aanat A C 11: 116,487,681 (GRCm39) T127P possibly damaging Het
Acp4 G A 7: 43,906,733 (GRCm39) probably benign Het
Arhgef5 T G 6: 43,250,527 (GRCm39) I426S probably benign Het
Bcl2a1a T C 9: 88,839,185 (GRCm39) S28P probably benign Het
Cd163 T C 6: 124,288,384 (GRCm39) S272P possibly damaging Het
Cdk13 C A 13: 17,978,542 (GRCm39) R232L unknown Het
Clrn2 A G 5: 45,611,331 (GRCm39) D60G possibly damaging Het
Cnot6l A G 5: 96,230,749 (GRCm39) L406P probably damaging Het
Cspg4 T G 9: 56,797,622 (GRCm39) V1362G probably benign Het
Cspp1 C T 1: 10,196,639 (GRCm39) S939L probably benign Het
Dcaf1 C T 9: 106,713,818 (GRCm39) T145I probably benign Het
Ddx28 T C 8: 106,736,733 (GRCm39) S442G probably benign Het
Dnajc3 A T 14: 119,209,775 (GRCm39) R283S probably benign Het
Dsc1 G A 18: 20,232,087 (GRCm39) T307I possibly damaging Het
Elovl5 T C 9: 77,868,291 (GRCm39) Y68H probably damaging Het
Fam25a G A 14: 34,077,266 (GRCm39) T17I probably damaging Het
Fryl T C 5: 73,216,879 (GRCm39) E2137G probably damaging Het
Gm10142 A G 10: 77,551,762 (GRCm39) Q41R unknown Het
Grm1 T C 10: 10,564,775 (GRCm39) T1178A possibly damaging Het
Hhip A T 8: 80,723,363 (GRCm39) H430Q probably damaging Het
Hip1 A G 5: 135,478,676 (GRCm39) F178L probably damaging Het
Impa1 T A 3: 10,393,430 (GRCm39) I58L probably benign Het
Irak4 T A 15: 94,451,812 (GRCm39) V135E probably benign Het
Jup A C 11: 100,274,237 (GRCm39) L151R probably damaging Het
Lrrn4cl T A 19: 8,829,419 (GRCm39) N132K probably damaging Het
Mapkbp1 C A 2: 119,851,664 (GRCm39) R863S probably benign Het
Or8k16 T C 2: 85,519,866 (GRCm39) F31S probably damaging Het
Pramel14 T A 4: 143,719,520 (GRCm39) M282L probably benign Het
Rasa4 A G 5: 136,124,383 (GRCm39) D144G probably benign Het
Rrs1 T A 1: 9,616,390 (GRCm39) S214R probably benign Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Rtca T A 3: 116,293,225 (GRCm39) R195S probably benign Het
Scarb1 A T 5: 125,371,194 (GRCm39) F293I possibly damaging Het
Snapc1 T C 12: 74,017,115 (GRCm39) probably null Het
Speer4a3 AACT A 5: 26,155,849 (GRCm39) probably benign Het
Spta1 T C 1: 174,032,925 (GRCm39) V994A probably damaging Het
Synpo2 T C 3: 122,911,366 (GRCm39) E93G probably damaging Het
Ubr4 A G 4: 139,191,341 (GRCm39) T985A unknown Het
Vmn1r18 T C 6: 57,367,463 (GRCm39) I30M possibly damaging Het
Vmn2r15 A G 5: 109,440,598 (GRCm39) V420A probably benign Het
Vmn2r6 A G 3: 64,464,081 (GRCm39) V251A probably benign Het
Zfyve16 A T 13: 92,659,311 (GRCm39) I200N possibly damaging Het
Other mutations in Scaper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Scaper APN 9 55,767,143 (GRCm39) missense probably damaging 0.99
IGL00912:Scaper APN 9 55,593,239 (GRCm39) missense probably damaging 1.00
IGL01469:Scaper APN 9 55,767,051 (GRCm39) missense probably damaging 1.00
IGL01626:Scaper APN 9 55,819,335 (GRCm39) missense possibly damaging 0.61
IGL01779:Scaper APN 9 55,799,524 (GRCm39) missense probably benign 0.20
IGL02011:Scaper APN 9 55,487,606 (GRCm39) missense probably damaging 1.00
IGL02997:Scaper APN 9 55,722,783 (GRCm39) missense probably damaging 1.00
IGL03107:Scaper APN 9 55,765,686 (GRCm39) splice site probably benign
IGL03167:Scaper APN 9 55,767,108 (GRCm39) missense probably damaging 1.00
IGL03293:Scaper APN 9 55,782,107 (GRCm39) missense probably benign
IGL03340:Scaper APN 9 55,510,116 (GRCm39) missense possibly damaging 0.88
IGL03368:Scaper APN 9 55,563,311 (GRCm39) missense possibly damaging 0.53
R0111:Scaper UTSW 9 55,510,074 (GRCm39) missense probably benign 0.01
R0510:Scaper UTSW 9 55,665,346 (GRCm39) splice site probably benign
R0531:Scaper UTSW 9 55,517,158 (GRCm39) missense possibly damaging 0.91
R0558:Scaper UTSW 9 55,593,207 (GRCm39) missense probably benign 0.08
R0605:Scaper UTSW 9 55,722,802 (GRCm39) splice site probably benign
R0646:Scaper UTSW 9 55,665,340 (GRCm39) missense probably damaging 1.00
R0837:Scaper UTSW 9 55,766,326 (GRCm39) nonsense probably null
R1440:Scaper UTSW 9 55,510,202 (GRCm39) nonsense probably null
R1548:Scaper UTSW 9 55,723,954 (GRCm39) missense probably damaging 1.00
R1777:Scaper UTSW 9 55,771,830 (GRCm39) missense probably benign 0.33
R1822:Scaper UTSW 9 55,767,184 (GRCm39) missense probably damaging 0.99
R1834:Scaper UTSW 9 55,724,018 (GRCm39) missense possibly damaging 0.90
R1870:Scaper UTSW 9 55,593,222 (GRCm39) missense probably damaging 1.00
R2102:Scaper UTSW 9 55,819,334 (GRCm39) missense probably benign 0.43
R2168:Scaper UTSW 9 55,650,923 (GRCm39) missense probably damaging 1.00
R2174:Scaper UTSW 9 55,766,321 (GRCm39) missense probably null 0.01
R3690:Scaper UTSW 9 55,791,205 (GRCm39) missense probably benign 0.00
R4392:Scaper UTSW 9 55,765,399 (GRCm39) missense probably damaging 0.99
R4418:Scaper UTSW 9 55,745,464 (GRCm39) missense probably damaging 1.00
R4606:Scaper UTSW 9 55,563,187 (GRCm39) critical splice donor site probably null
R4643:Scaper UTSW 9 55,745,463 (GRCm39) missense probably damaging 0.99
R4665:Scaper UTSW 9 55,819,339 (GRCm39) missense probably damaging 1.00
R4739:Scaper UTSW 9 55,650,932 (GRCm39) missense probably damaging 1.00
R4921:Scaper UTSW 9 55,799,519 (GRCm39) missense probably benign 0.02
R4934:Scaper UTSW 9 55,716,459 (GRCm39) missense probably damaging 1.00
R4956:Scaper UTSW 9 55,745,426 (GRCm39) missense probably damaging 1.00
R5055:Scaper UTSW 9 55,767,003 (GRCm39) splice site probably null
R5107:Scaper UTSW 9 55,487,616 (GRCm39) missense probably damaging 1.00
R5155:Scaper UTSW 9 55,463,370 (GRCm39) missense probably null 1.00
R5265:Scaper UTSW 9 55,771,830 (GRCm39) missense probably benign
R5408:Scaper UTSW 9 55,493,508 (GRCm39) missense probably damaging 0.99
R5623:Scaper UTSW 9 55,771,791 (GRCm39) missense probably benign 0.02
R5665:Scaper UTSW 9 55,714,916 (GRCm39) missense probably damaging 1.00
R5748:Scaper UTSW 9 55,766,360 (GRCm39) critical splice acceptor site probably null
R5771:Scaper UTSW 9 55,724,075 (GRCm39) missense probably damaging 1.00
R6534:Scaper UTSW 9 55,791,260 (GRCm39) missense probably benign 0.00
R6557:Scaper UTSW 9 55,458,134 (GRCm39) missense probably benign 0.02
R6651:Scaper UTSW 9 55,765,788 (GRCm39) missense probably benign 0.05
R6796:Scaper UTSW 9 55,771,711 (GRCm39) missense probably benign 0.00
R6962:Scaper UTSW 9 55,767,055 (GRCm39) missense probably benign 0.01
R7145:Scaper UTSW 9 55,819,395 (GRCm39) missense unknown
R7199:Scaper UTSW 9 55,745,460 (GRCm39) nonsense probably null
R7356:Scaper UTSW 9 55,799,495 (GRCm39) missense unknown
R7426:Scaper UTSW 9 55,669,561 (GRCm39) nonsense probably null
R7503:Scaper UTSW 9 55,715,038 (GRCm39) missense probably damaging 0.98
R7844:Scaper UTSW 9 55,722,732 (GRCm39) missense probably benign 0.04
R7966:Scaper UTSW 9 55,669,611 (GRCm39) missense probably damaging 0.98
R7992:Scaper UTSW 9 55,765,438 (GRCm39) missense probably benign 0.02
R8081:Scaper UTSW 9 55,823,330 (GRCm39) missense unknown
R8189:Scaper UTSW 9 55,819,404 (GRCm39) missense probably damaging 1.00
R8294:Scaper UTSW 9 55,517,280 (GRCm39) missense possibly damaging 0.62
R8351:Scaper UTSW 9 55,724,088 (GRCm39) missense possibly damaging 0.92
R8451:Scaper UTSW 9 55,724,088 (GRCm39) missense possibly damaging 0.92
R8473:Scaper UTSW 9 55,458,131 (GRCm39) missense probably damaging 1.00
R8476:Scaper UTSW 9 55,669,575 (GRCm39) missense probably damaging 1.00
R8504:Scaper UTSW 9 55,771,722 (GRCm39) missense probably benign
R9058:Scaper UTSW 9 55,722,762 (GRCm39) missense probably damaging 1.00
R9071:Scaper UTSW 9 55,771,803 (GRCm39) missense probably benign
R9099:Scaper UTSW 9 55,669,616 (GRCm39) missense probably damaging 0.98
R9104:Scaper UTSW 9 55,819,400 (GRCm39) missense unknown
R9516:Scaper UTSW 9 55,593,275 (GRCm39) missense probably benign 0.05
X0012:Scaper UTSW 9 55,563,214 (GRCm39) missense probably damaging 0.98
X0052:Scaper UTSW 9 55,723,948 (GRCm39) missense probably damaging 1.00
Z1176:Scaper UTSW 9 55,463,532 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTCTGTAAGGCATGAGG -3'
(R):5'- ACAGGTAAGTGCTCCTTCAC -3'

Sequencing Primer
(F):5'- GATAAGTTGTTCTTACCCAGTCAGC -3'
(R):5'- AGTGCTCCTTCACTTGATAGG -3'
Posted On 2022-10-06