Mutagenetix > Incidental Mutation

Incidental Mutation 'R9685:Scaper'

728801

Institutional Source

Beutler Lab

Gene Symbol

Scaper

Ensembl Gene

ENSMUSG00000034007

Gene Name

S phase cyclin A-associated protein in the ER

Synonyms

D530014O03Rik, Zfp291

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.654) question?

Stock #

R9685 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55549879-55938119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55864551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 360 (S360R)

Ref Sequence

ENSEMBL: ENSMUSP00000043411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]

AlphaFold

F8VQ70

Predicted Effect

probably benign
Transcript: ENSMUST00000037408
AA Change: S360R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: S360R

Domain	Start	End	E-Value	Type
Pfam:SCAPER_N	88	185	3.4e-47	PFAM
low complexity region	323	338	N/A	INTRINSIC
coiled coil region	415	466	N/A	INTRINSIC
coiled coil region	535	597	N/A	INTRINSIC
SCOP:d1eq1a_	605	769	3e-6	SMART
ZnF_C2H2	791	815	1.16e1	SMART
low complexity region	866	883	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000214747
AA Change: S360R

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000216595

Predicted Effect

probably benign
Transcript: ENSMUST00000217647
AA Change: S360R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930453N24Rik	G	T	16: 64,766,460	N300K	possibly damaging	Het
A130010J15Rik	G	A	1: 193,174,757	R139H	probably benign	Het
Aanat	A	C	11: 116,596,855	T127P	possibly damaging	Het
Acp4	G	A	7: 44,257,309		probably benign	Het
Arhgef5	T	G	6: 43,273,593	I426S	probably benign	Het
Bcl2a1a	T	C	9: 88,957,132	S28P	probably benign	Het
Cd163	T	C	6: 124,311,425	S272P	possibly damaging	Het
Cdk13	C	A	13: 17,803,957	R232L	unknown	Het
Clrn2	A	G	5: 45,453,989	D60G	possibly damaging	Het
Cnot6l	A	G	5: 96,082,890	L406P	probably damaging	Het
Cspg4	T	G	9: 56,890,338	V1362G	probably benign	Het
Cspp1	C	T	1: 10,126,414	S939L	probably benign	Het
Dcaf1	C	T	9: 106,836,619	T145I	probably benign	Het
Ddx28	T	C	8: 106,010,101	S442G	probably benign	Het
Dnajc3	A	T	14: 118,972,363	R283S	probably benign	Het
Dsc1	G	A	18: 20,099,030	T307I	possibly damaging	Het
Elovl5	T	C	9: 77,961,009	Y68H	probably damaging	Het
Fam25c	G	A	14: 34,355,309	T17I	probably damaging	Het
Fryl	T	C	5: 73,059,536	E2137G	probably damaging	Het
Gm10142	A	G	10: 77,715,928	Q41R	unknown	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Grm1	T	C	10: 10,689,031	T1178A	possibly damaging	Het
Hhip	A	T	8: 79,996,734	H430Q	probably damaging	Het
Hip1	A	G	5: 135,449,822	F178L	probably damaging	Het
Impa1	T	A	3: 10,328,370	I58L	probably benign	Het
Irak4	T	A	15: 94,553,931	V135E	probably benign	Het
Jup	A	C	11: 100,383,411	L151R	probably damaging	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Mapkbp1	C	A	2: 120,021,183	R863S	probably benign	Het
Olfr1008	T	C	2: 85,689,522	F31S	probably damaging	Het
Pramef17	T	A	4: 143,992,950	M282L	probably benign	Het
Rasa4	A	G	5: 136,095,529	D144G	probably benign	Het
Rrs1	T	A	1: 9,546,165	S214R	probably benign	Het
Rsf1	CGGC	CGGCGGCGGGGGC	7: 97,579,932		probably benign	Het
Rtca	T	A	3: 116,499,576	R195S	probably benign	Het
Scarb1	A	T	5: 125,294,130	F293I	possibly damaging	Het
Snapc1	T	C	12: 73,970,341		probably null	Het
Spta1	T	C	1: 174,205,359	V994A	probably damaging	Het
Synpo2	T	C	3: 123,117,717	E93G	probably damaging	Het
Ubr4	A	G	4: 139,464,030	T985A	unknown	Het
Vmn1r18	T	C	6: 57,390,478	I30M	possibly damaging	Het
Vmn2r15	A	G	5: 109,292,732	V420A	probably benign	Het
Vmn2r6	A	G	3: 64,556,660	V251A	probably benign	Het
Zfyve16	A	T	13: 92,522,803	I200N	possibly damaging	Het

Other mutations in Scaper

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00653:Scaper	APN	9	55859859	missense	probably damaging	0.99
IGL00912:Scaper	APN	9	55685955	missense	probably damaging	1.00
IGL01469:Scaper	APN	9	55859767	missense	probably damaging	1.00
IGL01626:Scaper	APN	9	55912051	missense	possibly damaging	0.61
IGL01779:Scaper	APN	9	55892240	missense	probably benign	0.20
IGL02011:Scaper	APN	9	55580322	missense	probably damaging	1.00
IGL02997:Scaper	APN	9	55815499	missense	probably damaging	1.00
IGL03107:Scaper	APN	9	55858402	splice site	probably benign
IGL03167:Scaper	APN	9	55859824	missense	probably damaging	1.00
IGL03293:Scaper	APN	9	55874823	missense	probably benign
IGL03340:Scaper	APN	9	55602832	missense	possibly damaging	0.88
IGL03368:Scaper	APN	9	55656027	missense	possibly damaging	0.53
R0111:Scaper	UTSW	9	55602790	missense	probably benign	0.01
R0510:Scaper	UTSW	9	55758062	splice site	probably benign
R0531:Scaper	UTSW	9	55609874	missense	possibly damaging	0.91
R0558:Scaper	UTSW	9	55685923	missense	probably benign	0.08
R0605:Scaper	UTSW	9	55815518	splice site	probably benign
R0646:Scaper	UTSW	9	55758056	missense	probably damaging	1.00
R0837:Scaper	UTSW	9	55859042	nonsense	probably null
R1440:Scaper	UTSW	9	55602918	nonsense	probably null
R1548:Scaper	UTSW	9	55816670	missense	probably damaging	1.00
R1777:Scaper	UTSW	9	55864546	missense	probably benign	0.33
R1822:Scaper	UTSW	9	55859900	missense	probably damaging	0.99
R1834:Scaper	UTSW	9	55816734	missense	possibly damaging	0.90
R1870:Scaper	UTSW	9	55685938	missense	probably damaging	1.00
R2102:Scaper	UTSW	9	55912050	missense	probably benign	0.43
R2168:Scaper	UTSW	9	55743639	missense	probably damaging	1.00
R2174:Scaper	UTSW	9	55859037	missense	probably null	0.01
R3690:Scaper	UTSW	9	55883921	missense	probably benign	0.00
R4392:Scaper	UTSW	9	55858115	missense	probably damaging	0.99
R4418:Scaper	UTSW	9	55838180	missense	probably damaging	1.00
R4606:Scaper	UTSW	9	55655903	critical splice donor site	probably null
R4643:Scaper	UTSW	9	55838179	missense	probably damaging	0.99
R4665:Scaper	UTSW	9	55912055	missense	probably damaging	1.00
R4739:Scaper	UTSW	9	55743648	missense	probably damaging	1.00
R4921:Scaper	UTSW	9	55892235	missense	probably benign	0.02
R4934:Scaper	UTSW	9	55809175	missense	probably damaging	1.00
R4956:Scaper	UTSW	9	55838142	missense	probably damaging	1.00
R5055:Scaper	UTSW	9	55859719	splice site	probably null
R5107:Scaper	UTSW	9	55580332	missense	probably damaging	1.00
R5155:Scaper	UTSW	9	55556086	missense	probably null	1.00
R5265:Scaper	UTSW	9	55864546	missense	probably benign
R5408:Scaper	UTSW	9	55586224	missense	probably damaging	0.99
R5623:Scaper	UTSW	9	55864507	missense	probably benign	0.02
R5665:Scaper	UTSW	9	55807632	missense	probably damaging	1.00
R5748:Scaper	UTSW	9	55859076	critical splice acceptor site	probably null
R5771:Scaper	UTSW	9	55816791	missense	probably damaging	1.00
R6534:Scaper	UTSW	9	55883976	missense	probably benign	0.00
R6557:Scaper	UTSW	9	55550850	missense	probably benign	0.02
R6651:Scaper	UTSW	9	55858504	missense	probably benign	0.05
R6796:Scaper	UTSW	9	55864427	missense	probably benign	0.00
R6962:Scaper	UTSW	9	55859771	missense	probably benign	0.01
R7145:Scaper	UTSW	9	55912111	missense	unknown
R7199:Scaper	UTSW	9	55838176	nonsense	probably null
R7356:Scaper	UTSW	9	55892211	missense	unknown
R7426:Scaper	UTSW	9	55762277	nonsense	probably null
R7503:Scaper	UTSW	9	55807754	missense	probably damaging	0.98
R7844:Scaper	UTSW	9	55815448	missense	probably benign	0.04
R7966:Scaper	UTSW	9	55762327	missense	probably damaging	0.98
R7992:Scaper	UTSW	9	55858154	missense	probably benign	0.02
R8081:Scaper	UTSW	9	55916046	missense	unknown
R8189:Scaper	UTSW	9	55912120	missense	probably damaging	1.00
R8294:Scaper	UTSW	9	55609996	missense	possibly damaging	0.62
R8351:Scaper	UTSW	9	55816804	missense	possibly damaging	0.92
R8451:Scaper	UTSW	9	55816804	missense	possibly damaging	0.92
R8473:Scaper	UTSW	9	55550847	missense	probably damaging	1.00
R8476:Scaper	UTSW	9	55762291	missense	probably damaging	1.00
R8504:Scaper	UTSW	9	55864438	missense	probably benign
R9058:Scaper	UTSW	9	55815478	missense	probably damaging	1.00
R9071:Scaper	UTSW	9	55864519	missense	probably benign
R9099:Scaper	UTSW	9	55762332	missense	probably damaging	0.98
R9104:Scaper	UTSW	9	55912116	missense	unknown
R9516:Scaper	UTSW	9	55685991	missense	probably benign	0.05
X0012:Scaper	UTSW	9	55655930	missense	probably damaging	0.98
X0052:Scaper	UTSW	9	55816664	missense	probably damaging	1.00
Z1176:Scaper	UTSW	9	55556248	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTTCTGTAAGGCATGAGG -3'
(R):5'- ACAGGTAAGTGCTCCTTCAC -3'

Sequencing Primer
(F):5'- GATAAGTTGTTCTTACCCAGTCAGC -3'
(R):5'- AGTGCTCCTTCACTTGATAGG -3'

Posted On

2022-10-06