Incidental Mutation 'R9685:Bcl2a1a'
ID 728804
Institutional Source Beutler Lab
Gene Symbol Bcl2a1a
Ensembl Gene ENSMUSG00000102037
Gene Name B cell leukemia/lymphoma 2 related protein A1a
Synonyms A1, Hbpa1, Bcl2a1, Bfl-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R9685 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 88956900-88962419 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88957132 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 28 (S28P)
Ref Sequence ENSEMBL: ENSMUSP00000096086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098485]
AlphaFold Q07440
PDB Structure STRUCTURE OF MOUSE A1 BOUND TO THE PUMA BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BMF BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BAK BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BID BH3-DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000098485
AA Change: S28P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096086
Gene: ENSMUSG00000102037
AA Change: S28P

DomainStartEndE-ValueType
BCL 37 140 2.45e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants show enhanced spontaneous apoptosis of neutrophils, while both heterozygous and homozygous null mutants lack LPS-induced neutrophil apoptosis inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik G T 16: 64,766,460 N300K possibly damaging Het
A130010J15Rik G A 1: 193,174,757 R139H probably benign Het
Aanat A C 11: 116,596,855 T127P possibly damaging Het
Acp4 G A 7: 44,257,309 probably benign Het
Arhgef5 T G 6: 43,273,593 I426S probably benign Het
Cd163 T C 6: 124,311,425 S272P possibly damaging Het
Cdk13 C A 13: 17,803,957 R232L unknown Het
Clrn2 A G 5: 45,453,989 D60G possibly damaging Het
Cnot6l A G 5: 96,082,890 L406P probably damaging Het
Cspg4 T G 9: 56,890,338 V1362G probably benign Het
Cspp1 C T 1: 10,126,414 S939L probably benign Het
Dcaf1 C T 9: 106,836,619 T145I probably benign Het
Ddx28 T C 8: 106,010,101 S442G probably benign Het
Dnajc3 A T 14: 118,972,363 R283S probably benign Het
Dsc1 G A 18: 20,099,030 T307I possibly damaging Het
Elovl5 T C 9: 77,961,009 Y68H probably damaging Het
Fam25c G A 14: 34,355,309 T17I probably damaging Het
Fryl T C 5: 73,059,536 E2137G probably damaging Het
Gm10142 A G 10: 77,715,928 Q41R unknown Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Grm1 T C 10: 10,689,031 T1178A possibly damaging Het
Hhip A T 8: 79,996,734 H430Q probably damaging Het
Hip1 A G 5: 135,449,822 F178L probably damaging Het
Impa1 T A 3: 10,328,370 I58L probably benign Het
Irak4 T A 15: 94,553,931 V135E probably benign Het
Jup A C 11: 100,383,411 L151R probably damaging Het
Lrrn4cl T A 19: 8,852,055 N132K probably damaging Het
Mapkbp1 C A 2: 120,021,183 R863S probably benign Het
Olfr1008 T C 2: 85,689,522 F31S probably damaging Het
Pramef17 T A 4: 143,992,950 M282L probably benign Het
Rasa4 A G 5: 136,095,529 D144G probably benign Het
Rrs1 T A 1: 9,546,165 S214R probably benign Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtca T A 3: 116,499,576 R195S probably benign Het
Scaper A T 9: 55,864,551 S360R probably benign Het
Scarb1 A T 5: 125,294,130 F293I possibly damaging Het
Snapc1 T C 12: 73,970,341 probably null Het
Spta1 T C 1: 174,205,359 V994A probably damaging Het
Synpo2 T C 3: 123,117,717 E93G probably damaging Het
Ubr4 A G 4: 139,464,030 T985A unknown Het
Vmn1r18 T C 6: 57,390,478 I30M possibly damaging Het
Vmn2r15 A G 5: 109,292,732 V420A probably benign Het
Vmn2r6 A G 3: 64,556,660 V251A probably benign Het
Zfyve16 A T 13: 92,522,803 I200N possibly damaging Het
Other mutations in Bcl2a1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Bcl2a1a APN 9 88957447 missense probably damaging 1.00
IGL02942:Bcl2a1a APN 9 88957042 utr 5 prime probably benign
R0064:Bcl2a1a UTSW 9 88957463 missense probably damaging 1.00
R1672:Bcl2a1a UTSW 9 88957450 missense probably damaging 1.00
R2511:Bcl2a1a UTSW 9 88957453 missense probably damaging 1.00
R4616:Bcl2a1a UTSW 9 88957453 missense probably damaging 1.00
R4618:Bcl2a1a UTSW 9 88957304 missense probably damaging 1.00
R4947:Bcl2a1a UTSW 9 88957282 missense probably damaging 1.00
R7584:Bcl2a1a UTSW 9 88957292 missense probably damaging 1.00
R8867:Bcl2a1a UTSW 9 88957450 missense probably damaging 1.00
R8900:Bcl2a1a UTSW 9 88957258 missense probably benign 0.17
Z1177:Bcl2a1a UTSW 9 88957466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGCTGTGACATGATGCAAAC -3'
(R):5'- TCCCCAGTTAATGATGCCATC -3'

Sequencing Primer
(F):5'- CAGCCTCCAGATATGATTAGGGTTC -3'
(R):5'- CCAGTTAATGATGCCATCTTCAAAC -3'
Posted On 2022-10-06