Incidental Mutation 'R9686:Slc9c1'
ID 728874
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, Slc9a10, spermNHE
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock # R9686 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45535309-45607001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45580214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 729 (V729A)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: V729A

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: V729A

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,357,041 F1209L probably benign Het
Adamts19 A G 18: 58,838,021 T226A probably benign Het
Akap13 A G 7: 75,586,336 T220A probably damaging Het
Ank2 T A 3: 126,946,901 E1778V unknown Het
Aspn T C 13: 49,557,353 I158T probably damaging Het
Btbd1 A G 7: 81,805,850 C258R probably damaging Het
Btla A G 16: 45,250,509 N278S probably damaging Het
Cap2 A G 13: 46,525,450 E12G probably damaging Het
Ccdc171 A G 4: 83,549,682 Y88C probably damaging Het
Ceacam3 C T 7: 17,158,198 L289F Het
Cenpj G A 14: 56,552,591 A667V probably benign Het
Clu G T 14: 65,975,005 G136C probably damaging Het
Col4a4 A T 1: 82,497,241 F626I unknown Het
Csf2ra A G 19: 61,225,191 F360S probably damaging Het
Cyp27b1 T A 10: 127,050,316 S289T probably benign Het
Dnah17 G T 11: 118,088,222 H1781Q possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fap T C 2: 62,573,513 K6R possibly damaging Het
Fcer1a A G 1: 173,225,413 V72A possibly damaging Het
Flnc T C 6: 29,456,435 S2211P possibly damaging Het
Gm20939 A T 17: 94,877,460 H512L probably damaging Het
Gm21964 T A 8: 110,109,931 W180R probably damaging Het
Gng12 T C 6: 67,017,545 S59P probably damaging Het
Grin1 A C 2: 25,313,510 I163S probably benign Het
Haus5 A G 7: 30,661,973 I74T probably benign Het
Hmcn1 G A 1: 150,737,605 P1357L probably damaging Het
Kcnv1 A G 15: 45,109,104 I461T probably benign Het
Kmo A G 1: 175,632,220 M1V probably null Het
Krt80 G A 15: 101,364,400 R107C probably damaging Het
Macf1 A G 4: 123,483,698 V1481A possibly damaging Het
Masp1 A G 16: 23,496,137 S125P probably damaging Het
Mroh2b C T 15: 4,945,123 P1195L probably benign Het
Neurl3 A T 1: 36,266,458 W223R probably benign Het
Olfr1034 A T 2: 86,046,991 I170F probably benign Het
Olfr172 T C 16: 58,760,763 K138E possibly damaging Het
Olfr63 A G 17: 33,268,879 T52A probably benign Het
Olfr996 T A 2: 85,579,996 Y252* probably null Het
Pcdhb4 A C 18: 37,309,890 Y751S probably damaging Het
Pcnx2 C A 8: 125,866,027 A733S probably benign Het
Pde4a A G 9: 21,206,266 E608G probably benign Het
Pfdn2 G A 1: 171,357,809 E98K unknown Het
Pikfyve T A 1: 65,252,456 V1278D probably damaging Het
Ptprb A T 10: 116,368,789 T1843S probably damaging Het
Rab12 G T 17: 66,519,518 A66E probably benign Het
Ralyl T C 3: 13,776,827 probably benign Het
Rbm47 A T 5: 66,022,626 probably null Het
Rev3l T A 10: 39,867,388 D3038E possibly damaging Het
Rhobtb2 A G 14: 69,796,556 F407L probably benign Het
S100pbp A T 4: 129,155,478 D332E probably damaging Het
Slfn5 A T 11: 82,957,175 E295D probably benign Het
Smarcc2 A G 10: 128,480,906 S518G probably damaging Het
Sorbs1 T C 19: 40,393,510 D29G probably damaging Het
Spata13 G A 14: 60,751,659 E925K probably damaging Het
Spen A G 4: 141,472,635 S2894P probably benign Het
Taar7a G A 10: 23,993,411 T24I probably benign Het
Taf4b C A 18: 14,799,158 T189N possibly damaging Het
Ube2o A T 11: 116,543,953 C561S probably benign Het
Usp34 T A 11: 23,474,351 I3213N Het
Vmn1r103 A G 7: 20,510,428 V36A possibly damaging Het
Vmn2r65 G A 7: 84,940,876 L611F probably benign Het
Zfp51 C T 17: 21,463,609 S162F probably damaging Het
Zfp518b G A 5: 38,674,114 H183Y probably damaging Het
Zfp622 A G 15: 25,985,055 E169G probably benign Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Zfp839 A T 12: 110,855,498 I249F probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45580127 missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45599781 missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45577912 missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45550188 missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45593485 missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45575407 missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45560342 missense probably benign 0.13
R9695:Slc9c1 UTSW 16 45547663 missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45580253 missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACTGGTAATGTTTGCATTCCC -3'
(R):5'- TGAAGGTAGCTGAATGGCTTAAAC -3'

Sequencing Primer
(F):5'- GCCACTGAGAGTTTGAGTACACTTAG -3'
(R):5'- GCTGAATGGCTTAAACATCAGC -3'
Posted On 2022-10-06