Incidental Mutation 'R9686:Slc9c1'
ID 728874
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R9686 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45400577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 729 (V729A)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: V729A

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: V729A

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,247,867 (GRCm39) F1209L probably benign Het
Adamts19 A G 18: 58,971,093 (GRCm39) T226A probably benign Het
Akap13 A G 7: 75,236,084 (GRCm39) T220A probably damaging Het
Ank2 T A 3: 126,740,550 (GRCm39) E1778V unknown Het
Aspn T C 13: 49,710,829 (GRCm39) I158T probably damaging Het
Btbd1 A G 7: 81,455,598 (GRCm39) C258R probably damaging Het
Btla A G 16: 45,070,872 (GRCm39) N278S probably damaging Het
Cap2 A G 13: 46,678,926 (GRCm39) E12G probably damaging Het
Ccdc171 A G 4: 83,467,919 (GRCm39) Y88C probably damaging Het
Ceacam3 C T 7: 16,892,123 (GRCm39) L289F Het
Cenpj G A 14: 56,790,048 (GRCm39) A667V probably benign Het
Clu G T 14: 66,212,454 (GRCm39) G136C probably damaging Het
Col4a4 A T 1: 82,474,962 (GRCm39) F626I unknown Het
Csf2ra A G 19: 61,213,629 (GRCm39) F360S probably damaging Het
Cyp27b1 T A 10: 126,886,185 (GRCm39) S289T probably benign Het
Dnah17 G T 11: 117,979,048 (GRCm39) H1781Q possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Fap T C 2: 62,403,857 (GRCm39) K6R possibly damaging Het
Fcer1a A G 1: 173,052,980 (GRCm39) V72A possibly damaging Het
Flnc T C 6: 29,456,434 (GRCm39) S2211P possibly damaging Het
Gm20939 A T 17: 95,184,888 (GRCm39) H512L probably damaging Het
Gng12 T C 6: 66,994,529 (GRCm39) S59P probably damaging Het
Grin1 A C 2: 25,203,522 (GRCm39) I163S probably benign Het
Haus5 A G 7: 30,361,398 (GRCm39) I74T probably benign Het
Hmcn1 G A 1: 150,613,356 (GRCm39) P1357L probably damaging Het
Kcnv1 A G 15: 44,972,500 (GRCm39) I461T probably benign Het
Kmo A G 1: 175,459,786 (GRCm39) M1V probably null Het
Krt80 G A 15: 101,262,281 (GRCm39) R107C probably damaging Het
Macf1 A G 4: 123,377,491 (GRCm39) V1481A possibly damaging Het
Masp1 A G 16: 23,314,887 (GRCm39) S125P probably damaging Het
Mroh2b C T 15: 4,974,605 (GRCm39) P1195L probably benign Het
Neurl3 A T 1: 36,305,539 (GRCm39) W223R probably benign Het
Or10h28 A G 17: 33,487,853 (GRCm39) T52A probably benign Het
Or5g27 T A 2: 85,410,340 (GRCm39) Y252* probably null Het
Or5k1b T C 16: 58,581,126 (GRCm39) K138E possibly damaging Het
Or5m9 A T 2: 85,877,335 (GRCm39) I170F probably benign Het
Pcdhb4 A C 18: 37,442,943 (GRCm39) Y751S probably damaging Het
Pcnx2 C A 8: 126,592,766 (GRCm39) A733S probably benign Het
Pde4a A G 9: 21,117,562 (GRCm39) E608G probably benign Het
Pfdn2 G A 1: 171,185,377 (GRCm39) E98K unknown Het
Pikfyve T A 1: 65,291,615 (GRCm39) V1278D probably damaging Het
Ptprb A T 10: 116,204,694 (GRCm39) T1843S probably damaging Het
Rab12 G T 17: 66,826,513 (GRCm39) A66E probably benign Het
Ralyl T C 3: 13,841,887 (GRCm39) probably benign Het
Rbm47 A T 5: 66,179,969 (GRCm39) probably null Het
Rev3l T A 10: 39,743,384 (GRCm39) D3038E possibly damaging Het
Rhobtb2 A G 14: 70,034,005 (GRCm39) F407L probably benign Het
S100pbp A T 4: 129,049,271 (GRCm39) D332E probably damaging Het
Slfn5 A T 11: 82,848,001 (GRCm39) E295D probably benign Het
Smarcc2 A G 10: 128,316,775 (GRCm39) S518G probably damaging Het
Sorbs1 T C 19: 40,381,954 (GRCm39) D29G probably damaging Het
Spata13 G A 14: 60,989,108 (GRCm39) E925K probably damaging Het
Spen A G 4: 141,199,946 (GRCm39) S2894P probably benign Het
Taar7a G A 10: 23,869,309 (GRCm39) T24I probably benign Het
Taf4b C A 18: 14,932,215 (GRCm39) T189N possibly damaging Het
Tle7 T A 8: 110,836,563 (GRCm39) W180R probably damaging Het
Ube2o A T 11: 116,434,779 (GRCm39) C561S probably benign Het
Usp34 T A 11: 23,424,351 (GRCm39) I3213N Het
Vmn1r103 A G 7: 20,244,353 (GRCm39) V36A possibly damaging Het
Vmn2r65 G A 7: 84,590,084 (GRCm39) L611F probably benign Het
Zfp51 C T 17: 21,683,871 (GRCm39) S162F probably damaging Het
Zfp518b G A 5: 38,831,457 (GRCm39) H183Y probably damaging Het
Zfp622 A G 15: 25,985,141 (GRCm39) E169G probably benign Het
Zfp703 A G 8: 27,469,044 (GRCm39) D236G probably damaging Het
Zfp839 A T 12: 110,821,932 (GRCm39) I249F probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACTGGTAATGTTTGCATTCCC -3'
(R):5'- TGAAGGTAGCTGAATGGCTTAAAC -3'

Sequencing Primer
(F):5'- GCCACTGAGAGTTTGAGTACACTTAG -3'
(R):5'- GCTGAATGGCTTAAACATCAGC -3'
Posted On 2022-10-06