Incidental Mutation 'R9687:Susd4'
ID 728888
Institutional Source Beutler Lab
Gene Symbol Susd4
Ensembl Gene ENSMUSG00000038576
Gene Name sushi domain containing 4
Synonyms E430021N18Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.397) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 182763860-182896591 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 182895197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085724] [ENSMUST00000153348]
AlphaFold Q8BH32
Predicted Effect probably null
Transcript: ENSMUST00000085724
SMART Domains Protein: ENSMUSP00000082873
Gene: ENSMUSG00000038576

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CCP 57 117 4.59e-10 SMART
CCP 122 177 2.58e-4 SMART
CCP 180 237 1.06e-14 SMART
CCP 243 302 1.3e-9 SMART
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 351 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153348
SMART Domains Protein: ENSMUSP00000119488
Gene: ENSMUSG00000038576

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CCP 57 117 4.59e-10 SMART
CCP 122 177 2.58e-4 SMART
CCP 180 237 1.06e-14 SMART
CCP 243 302 1.3e-9 SMART
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 351 374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,948,422 L446P probably damaging Het
Abcc9 T C 6: 142,633,163 T927A probably benign Het
Abraxas2 A G 7: 132,880,848 T258A probably benign Het
Akna A T 4: 63,374,437 C1078* probably null Het
Arhgap24 T A 5: 102,846,156 F34L probably benign Het
Cpa5 C T 6: 30,614,042 T61I probably benign Het
Crebrf A G 17: 26,763,627 *654W probably null Het
Dchs1 C A 7: 105,757,984 R2134L probably damaging Het
Dcps T C 9: 35,124,682 N303D probably damaging Het
Ddhd1 C T 14: 45,610,733 E527K probably damaging Het
Dnah14 T A 1: 181,598,413 M174K probably benign Het
Ehd1 A G 19: 6,298,300 D436G Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etv1 T C 12: 38,861,362 Y396H probably damaging Het
Fam189a2 A G 19: 23,979,665 I327T probably damaging Het
Fbxo11 A G 17: 88,009,066 I293T Het
Gcfc2 T A 6: 81,941,342 S338T probably damaging Het
Gm10272 T C 10: 77,706,930 V102A possibly damaging Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm17359 G A 3: 79,429,992 D36N possibly damaging Het
Gna14 G A 19: 16,604,986 R206Q Het
Gpm6a T C 8: 55,050,174 Y153H possibly damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
H2-M10.6 G A 17: 36,814,255 V313I probably benign Het
Igkv8-19 T C 6: 70,341,021 I74V probably benign Het
Kif24 A G 4: 41,428,546 L138P probably damaging Het
Kif26a A G 12: 112,177,191 E1293G probably damaging Het
Lrp1 A C 10: 127,566,693 L2203R probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Ncdn G A 4: 126,748,674 R397W probably damaging Het
Ncor1 A T 11: 62,369,367 I519N possibly damaging Het
Obsl1 A G 1: 75,503,026 V575A probably damaging Het
Olfr1031 G T 2: 85,991,876 V20L probably benign Het
Olfr1351 T A 10: 79,018,009 I229N probably damaging Het
Olfr1387 T C 11: 49,459,691 F4S probably benign Het
Osbpl5 A G 7: 143,693,861 Y747H possibly damaging Het
Pcdh18 T A 3: 49,756,587 D93V probably damaging Het
Ppef2 T A 5: 92,238,887 D397V probably benign Het
Ppfia4 G A 1: 134,317,956 T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 S178P probably damaging Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Pxk A G 14: 8,151,567 I461V possibly damaging Het
Rab18 T A 18: 6,784,622 N104K probably benign Het
Sars A G 3: 108,435,905 L90P probably benign Het
Scaf8 T A 17: 3,171,135 I299N unknown Het
Sh3bp2 C T 5: 34,559,633 P463S probably benign Het
Slc12a3 A G 8: 94,348,580 N734S possibly damaging Het
Slc12a7 G T 13: 73,790,677 R191L probably damaging Het
Slc7a12 A G 3: 14,480,900 Y35C possibly damaging Het
Taar7f G A 10: 24,049,829 R107K probably benign Het
Tarm1 T C 7: 3,495,941 T237A probably benign Het
Tshr C A 12: 91,537,665 A459E probably damaging Het
Tubgcp5 G T 7: 55,825,579 probably null Het
Unc13b T C 4: 43,174,920 V1916A unknown Het
Unc45b A G 11: 82,919,736 D274G probably damaging Het
Vmn1r230 T A 17: 20,847,342 Y264* probably null Het
Vmn2r109 G T 17: 20,555,070 Q132K Het
Zbtb20 A G 16: 43,609,797 S151G possibly damaging Het
Zbtb22 A C 17: 33,917,876 T332P probably damaging Het
Zc3h6 A G 2: 129,017,361 D1104G probably damaging Het
Zfp748 A G 13: 67,542,352 V263A probably benign Het
Zhx3 A C 2: 160,781,758 V163G probably benign Het
Other mutations in Susd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Susd4 APN 1 182891987 missense probably damaging 1.00
IGL01618:Susd4 APN 1 182858461 splice site probably null
IGL02505:Susd4 APN 1 182892080 missense probably benign 0.09
R0315:Susd4 UTSW 1 182858512 missense probably benign
R1668:Susd4 UTSW 1 182858563 missense probably benign 0.11
R1704:Susd4 UTSW 1 182854113 missense probably damaging 1.00
R1730:Susd4 UTSW 1 182853978 missense probably damaging 1.00
R2171:Susd4 UTSW 1 182892194 missense probably benign
R3912:Susd4 UTSW 1 182887466 missense probably damaging 1.00
R4601:Susd4 UTSW 1 182858460 missense probably damaging 1.00
R4701:Susd4 UTSW 1 182892061 missense probably damaging 0.99
R5256:Susd4 UTSW 1 182892259 missense possibly damaging 0.95
R5279:Susd4 UTSW 1 182887478 missense probably damaging 1.00
R5598:Susd4 UTSW 1 182892070 missense probably benign 0.00
R6715:Susd4 UTSW 1 182892037 missense probably benign 0.19
R7023:Susd4 UTSW 1 182765048 missense probably damaging 0.99
R7056:Susd4 UTSW 1 182833156 missense probably benign 0.31
R7788:Susd4 UTSW 1 182895202 missense possibly damaging 0.94
R7832:Susd4 UTSW 1 182858505 missense probably benign 0.03
R8075:Susd4 UTSW 1 182765183 missense possibly damaging 0.80
R8683:Susd4 UTSW 1 182892267 critical splice donor site probably null
R9039:Susd4 UTSW 1 182854032 missense probably benign
R9267:Susd4 UTSW 1 182888824 missense probably benign 0.03
R9437:Susd4 UTSW 1 182854132 critical splice donor site probably null
R9474:Susd4 UTSW 1 182892100 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTAGCGGATAGATGGTGTACAG -3'
(R):5'- ATTTGAAAGCACCGCCTTTGC -3'

Sequencing Primer
(F):5'- TAGATGGTGTACAGGGCGG -3'
(R):5'- TTGCTGTTGGCCAGACC -3'
Posted On 2022-10-06