Incidental Mutation 'R9687:Zc3h6'
ID 728890
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128967402-129018563 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129017361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1104 (D1104G)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110320
AA Change: D1104G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: D1104G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,948,422 L446P probably damaging Het
Abcc9 T C 6: 142,633,163 T927A probably benign Het
Abraxas2 A G 7: 132,880,848 T258A probably benign Het
Akna A T 4: 63,374,437 C1078* probably null Het
Arhgap24 T A 5: 102,846,156 F34L probably benign Het
Cpa5 C T 6: 30,614,042 T61I probably benign Het
Crebrf A G 17: 26,763,627 *654W probably null Het
Dchs1 C A 7: 105,757,984 R2134L probably damaging Het
Dcps T C 9: 35,124,682 N303D probably damaging Het
Ddhd1 C T 14: 45,610,733 E527K probably damaging Het
Dnah14 T A 1: 181,598,413 M174K probably benign Het
Ehd1 A G 19: 6,298,300 D436G Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etv1 T C 12: 38,861,362 Y396H probably damaging Het
Fam189a2 A G 19: 23,979,665 I327T probably damaging Het
Fbxo11 A G 17: 88,009,066 I293T Het
Gcfc2 T A 6: 81,941,342 S338T probably damaging Het
Gm10272 T C 10: 77,706,930 V102A possibly damaging Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm17359 G A 3: 79,429,992 D36N possibly damaging Het
Gna14 G A 19: 16,604,986 R206Q Het
Gpm6a T C 8: 55,050,174 Y153H possibly damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
H2-M10.6 G A 17: 36,814,255 V313I probably benign Het
Igkv8-19 T C 6: 70,341,021 I74V probably benign Het
Kif24 A G 4: 41,428,546 L138P probably damaging Het
Kif26a A G 12: 112,177,191 E1293G probably damaging Het
Lrp1 A C 10: 127,566,693 L2203R probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Ncdn G A 4: 126,748,674 R397W probably damaging Het
Ncor1 A T 11: 62,369,367 I519N possibly damaging Het
Obsl1 A G 1: 75,503,026 V575A probably damaging Het
Olfr1031 G T 2: 85,991,876 V20L probably benign Het
Olfr1351 T A 10: 79,018,009 I229N probably damaging Het
Olfr1387 T C 11: 49,459,691 F4S probably benign Het
Osbpl5 A G 7: 143,693,861 Y747H possibly damaging Het
Pcdh18 T A 3: 49,756,587 D93V probably damaging Het
Ppef2 T A 5: 92,238,887 D397V probably benign Het
Ppfia4 G A 1: 134,317,956 T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 S178P probably damaging Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Pxk A G 14: 8,151,567 I461V possibly damaging Het
Rab18 T A 18: 6,784,622 N104K probably benign Het
Sars A G 3: 108,435,905 L90P probably benign Het
Scaf8 T A 17: 3,171,135 I299N unknown Het
Sh3bp2 C T 5: 34,559,633 P463S probably benign Het
Slc12a3 A G 8: 94,348,580 N734S possibly damaging Het
Slc12a7 G T 13: 73,790,677 R191L probably damaging Het
Slc7a12 A G 3: 14,480,900 Y35C possibly damaging Het
Susd4 A G 1: 182,895,197 probably null Het
Taar7f G A 10: 24,049,829 R107K probably benign Het
Tarm1 T C 7: 3,495,941 T237A probably benign Het
Tshr C A 12: 91,537,665 A459E probably damaging Het
Tubgcp5 G T 7: 55,825,579 probably null Het
Unc13b T C 4: 43,174,920 V1916A unknown Het
Unc45b A G 11: 82,919,736 D274G probably damaging Het
Vmn1r230 T A 17: 20,847,342 Y264* probably null Het
Vmn2r109 G T 17: 20,555,070 Q132K Het
Zbtb20 A G 16: 43,609,797 S151G possibly damaging Het
Zbtb22 A C 17: 33,917,876 T332P probably damaging Het
Zfp748 A G 13: 67,542,352 V263A probably benign Het
Zhx3 A C 2: 160,781,758 V163G probably benign Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R8877:Zc3h6 UTSW 2 129014399 nonsense probably null
R9076:Zc3h6 UTSW 2 129017176 nonsense probably null
R9577:Zc3h6 UTSW 2 129016182 missense
R9745:Zc3h6 UTSW 2 129017235 missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTAGGGATAAAGGTTCGTTATC -3'
(R):5'- AAACGGTGATGCAGTTGGATC -3'

Sequencing Primer
(F):5'- CGTTATCTGCAATGGAGCTATCAACC -3'
(R):5'- GATGCAGTTGGATCAAACGTC -3'
Posted On 2022-10-06