Incidental Mutation 'R9687:Zhx3'
ID 728891
Institutional Source Beutler Lab
Gene Symbol Zhx3
Ensembl Gene ENSMUSG00000035877
Gene Name zinc fingers and homeoboxes 3
Synonyms Tix1, 1810059C13Rik, 9530010N21Rik, 4932418O04Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 160612367-160714910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 160623678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 163 (V163G)
Ref Sequence ENSEMBL: ENSMUSP00000099400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000109460] [ENSMUST00000127201] [ENSMUST00000176141]
AlphaFold Q8C0Q2
Predicted Effect probably benign
Transcript: ENSMUST00000103111
AA Change: V163G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877
AA Change: V163G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103112
AA Change: V163G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877
AA Change: V163G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109460
AA Change: V163G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105086
Gene: ENSMUSG00000035877
AA Change: V163G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 841 888 1.3e-17 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127201
SMART Domains Protein: ENSMUSP00000120488
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176141
SMART Domains Protein: ENSMUSP00000134763
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc fingers and homeoboxes (ZHX) gene family. The encoded protein contains two C2H2-type zinc fingers and five homeodomains and forms a dimer with itself or with zinc fingers and homeoboxes family member 1. In the nucleus, the dimerized protein interacts with the A subunit of the ubiquitous transcription factor nuclear factor-Y and may function as a transcriptional repressor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Other mutations in Zhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zhx3 APN 2 160,622,761 (GRCm39) missense probably damaging 0.99
IGL01759:Zhx3 APN 2 160,622,634 (GRCm39) missense probably damaging 1.00
IGL02170:Zhx3 APN 2 160,621,718 (GRCm39) missense probably damaging 1.00
IGL02550:Zhx3 APN 2 160,623,216 (GRCm39) missense probably damaging 1.00
R0497:Zhx3 UTSW 2 160,621,914 (GRCm39) nonsense probably null
R0882:Zhx3 UTSW 2 160,622,629 (GRCm39) missense probably damaging 1.00
R1396:Zhx3 UTSW 2 160,622,940 (GRCm39) missense possibly damaging 0.90
R1587:Zhx3 UTSW 2 160,623,613 (GRCm39) splice site probably null
R1646:Zhx3 UTSW 2 160,623,195 (GRCm39) missense probably damaging 1.00
R1822:Zhx3 UTSW 2 160,622,275 (GRCm39) missense probably benign 0.03
R2322:Zhx3 UTSW 2 160,623,948 (GRCm39) missense probably damaging 1.00
R3791:Zhx3 UTSW 2 160,622,368 (GRCm39) missense possibly damaging 0.94
R3899:Zhx3 UTSW 2 160,622,371 (GRCm39) missense possibly damaging 0.82
R4003:Zhx3 UTSW 2 160,622,809 (GRCm39) missense probably damaging 0.96
R4619:Zhx3 UTSW 2 160,623,879 (GRCm39) missense probably damaging 0.96
R5307:Zhx3 UTSW 2 160,621,788 (GRCm39) missense probably benign 0.02
R5461:Zhx3 UTSW 2 160,621,938 (GRCm39) missense probably benign
R5648:Zhx3 UTSW 2 160,623,881 (GRCm39) missense probably damaging 1.00
R5952:Zhx3 UTSW 2 160,623,937 (GRCm39) missense probably damaging 1.00
R6035:Zhx3 UTSW 2 160,621,463 (GRCm39) missense probably benign
R6035:Zhx3 UTSW 2 160,621,463 (GRCm39) missense probably benign
R6734:Zhx3 UTSW 2 160,623,640 (GRCm39) missense probably damaging 0.99
R6988:Zhx3 UTSW 2 160,621,788 (GRCm39) missense probably benign 0.02
R7032:Zhx3 UTSW 2 160,622,898 (GRCm39) missense probably damaging 1.00
R7288:Zhx3 UTSW 2 160,623,042 (GRCm39) missense probably damaging 1.00
R7348:Zhx3 UTSW 2 160,624,038 (GRCm39) nonsense probably null
R7947:Zhx3 UTSW 2 160,623,015 (GRCm39) missense probably damaging 1.00
R8101:Zhx3 UTSW 2 160,623,619 (GRCm39) missense probably damaging 0.99
R8152:Zhx3 UTSW 2 160,622,695 (GRCm39) missense probably benign
R8831:Zhx3 UTSW 2 160,622,691 (GRCm39) missense probably benign 0.05
R8886:Zhx3 UTSW 2 160,623,216 (GRCm39) missense probably damaging 1.00
R9310:Zhx3 UTSW 2 160,621,393 (GRCm39) missense possibly damaging 0.94
R9363:Zhx3 UTSW 2 160,621,785 (GRCm39) missense probably benign 0.00
R9422:Zhx3 UTSW 2 160,624,020 (GRCm39) missense probably benign 0.00
RF002:Zhx3 UTSW 2 160,623,726 (GRCm39) missense probably damaging 0.98
Z1088:Zhx3 UTSW 2 160,621,675 (GRCm39) unclassified probably benign
Z1176:Zhx3 UTSW 2 160,622,980 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGACTTAGCAGATGCCTG -3'
(R):5'- CCCAACTTTTGTATGTACAGGGTG -3'

Sequencing Primer
(F):5'- CTGCCCCATTGATGAAAGTG -3'
(R):5'- ATGTACAGGGTGCAGTTTCC -3'
Posted On 2022-10-06