Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Pcdh18'

728893

Institutional Source

Beutler Lab

Gene Symbol

Pcdh18

Ensembl Gene

ENSMUSG00000037892

Gene Name

protocadherin 18

Synonyms

PCDH68L

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49743296-49757325 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49756587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 93 (D93V)

Ref Sequence

ENSEMBL: ENSMUSP00000039245 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]

AlphaFold

Q8VHR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035931
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: D93V

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
CA	51	135	1.36e-1	SMART
CA	159	244	3.78e-20	SMART
CA	268	352	1.12e-22	SMART
CA	382	463	5.76e-25	SMART
CA	487	574	2.51e-25	SMART
CA	603	684	8e-3	SMART
transmembrane domain	698	720	N/A	INTRINSIC
low complexity region	772	783	N/A	INTRINSIC
low complexity region	988	1009	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000191794
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892
AA Change: D93V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	51	135	6.6e-4	SMART
CA	159	244	1.9e-22	SMART
CA	268	352	5.6e-25	SMART
CA	382	463	2.7e-27	SMART
CA	487	574	1.2e-27	SMART
CA	603	684	3.9e-5	SMART
transmembrane domain	698	720	N/A	INTRINSIC
low complexity region	772	783	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194603

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Pcdh18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Pcdh18	APN	3	49753379	missense	probably damaging	1.00
IGL00639:Pcdh18	APN	3	49755616	missense	probably benign	0.34
IGL00954:Pcdh18	APN	3	49756389	missense	probably damaging	1.00
IGL01338:Pcdh18	APN	3	49756141	missense	probably damaging	1.00
IGL01339:Pcdh18	APN	3	49755798	missense	probably benign	0.35
IGL01687:Pcdh18	APN	3	49753533	splice site	probably benign
IGL01727:Pcdh18	APN	3	49755700	missense	probably damaging	0.99
IGL01788:Pcdh18	APN	3	49755922	nonsense	probably null
IGL01824:Pcdh18	APN	3	49754774	missense	probably damaging	1.00
IGL01834:Pcdh18	APN	3	49756830	missense	probably benign	0.03
IGL01913:Pcdh18	APN	3	49755249	missense	possibly damaging	0.94
IGL01915:Pcdh18	APN	3	49744921	missense	probably benign
IGL02095:Pcdh18	APN	3	49756156	missense	probably benign	0.01
IGL02128:Pcdh18	APN	3	49756686	missense	possibly damaging	0.65
IGL02302:Pcdh18	APN	3	49755938	missense	probably benign
IGL02342:Pcdh18	APN	3	49756044	missense	probably damaging	1.00
IGL02440:Pcdh18	APN	3	49744603	utr 3 prime	probably benign
IGL02499:Pcdh18	APN	3	49753447	missense	probably benign	0.15
IGL02570:Pcdh18	APN	3	49756625	missense	probably benign	0.02
IGL02745:Pcdh18	APN	3	49755891	missense	probably damaging	1.00
IGL03073:Pcdh18	APN	3	49753367	missense	possibly damaging	0.93
PIT4469001:Pcdh18	UTSW	3	49755069	missense	probably benign
R0078:Pcdh18	UTSW	3	49756344	missense	probably damaging	1.00
R0196:Pcdh18	UTSW	3	49756698	splice site	probably null
R0524:Pcdh18	UTSW	3	49755642	missense	probably damaging	0.98
R0661:Pcdh18	UTSW	3	49753318	missense	possibly damaging	0.64
R0900:Pcdh18	UTSW	3	49756803	missense	probably benign	0.25
R1101:Pcdh18	UTSW	3	49753379	missense	probably damaging	1.00
R1463:Pcdh18	UTSW	3	49755405	missense	probably damaging	0.99
R1778:Pcdh18	UTSW	3	49755634	missense	probably benign	0.19
R1850:Pcdh18	UTSW	3	49756405	missense	probably benign	0.22
R1875:Pcdh18	UTSW	3	49754705	missense	probably damaging	0.99
R1903:Pcdh18	UTSW	3	49755447	missense	probably benign
R1956:Pcdh18	UTSW	3	49755951	missense	probably benign
R2044:Pcdh18	UTSW	3	49754940	missense	probably benign
R2303:Pcdh18	UTSW	3	49755274	missense	probably damaging	1.00
R3732:Pcdh18	UTSW	3	49754791	missense	probably benign
R3732:Pcdh18	UTSW	3	49754791	missense	probably benign
R3733:Pcdh18	UTSW	3	49754791	missense	probably benign
R3973:Pcdh18	UTSW	3	49754586	missense	probably damaging	1.00
R4281:Pcdh18	UTSW	3	49756533	missense	possibly damaging	0.76
R4601:Pcdh18	UTSW	3	49744725	missense	probably damaging	1.00
R4631:Pcdh18	UTSW	3	49756441	missense	probably damaging	0.99
R4752:Pcdh18	UTSW	3	49755114	missense	probably damaging	1.00
R4840:Pcdh18	UTSW	3	49744668	missense	probably damaging	0.98
R4867:Pcdh18	UTSW	3	49754664	missense	probably damaging	1.00
R5007:Pcdh18	UTSW	3	49754457	missense	probably benign	0.23
R5039:Pcdh18	UTSW	3	49754856	missense	probably benign
R5169:Pcdh18	UTSW	3	49755966	missense	possibly damaging	0.65
R5438:Pcdh18	UTSW	3	49756016	nonsense	probably null
R5579:Pcdh18	UTSW	3	49744977	missense	probably damaging	1.00
R6000:Pcdh18	UTSW	3	49754464	missense	probably damaging	0.99
R6220:Pcdh18	UTSW	3	49745251	missense	probably damaging	1.00
R6737:Pcdh18	UTSW	3	49755895	missense	probably damaging	0.98
R6789:Pcdh18	UTSW	3	49755915	missense	probably benign	0.00
R7011:Pcdh18	UTSW	3	49754782	missense	probably benign
R7146:Pcdh18	UTSW	3	49755822	missense	probably damaging	1.00
R7150:Pcdh18	UTSW	3	49754694	missense	probably benign	0.31
R7205:Pcdh18	UTSW	3	49755474	missense	probably benign
R7326:Pcdh18	UTSW	3	49756860	missense	probably benign
R7413:Pcdh18	UTSW	3	49744783	missense	possibly damaging	0.94
R7755:Pcdh18	UTSW	3	49754829	missense	possibly damaging	0.59
R7848:Pcdh18	UTSW	3	49755997	missense	possibly damaging	0.54
R8169:Pcdh18	UTSW	3	49745235	missense	probably damaging	1.00
R8264:Pcdh18	UTSW	3	49756581	missense	probably damaging	1.00
R8352:Pcdh18	UTSW	3	49745175	missense	possibly damaging	0.81
R8406:Pcdh18	UTSW	3	49756549	missense	probably damaging	1.00
R8452:Pcdh18	UTSW	3	49745175	missense	possibly damaging	0.81
R8489:Pcdh18	UTSW	3	49754589	missense	probably damaging	1.00
R8526:Pcdh18	UTSW	3	49755574	missense	probably damaging	1.00
R9075:Pcdh18	UTSW	3	49744890	missense	probably benign
R9285:Pcdh18	UTSW	3	49753337	missense	probably damaging	0.97
R9316:Pcdh18	UTSW	3	49754640	missense	probably damaging	1.00
R9339:Pcdh18	UTSW	3	49754886	missense	probably damaging	1.00
R9410:Pcdh18	UTSW	3	49745166	missense	probably damaging	1.00
R9425:Pcdh18	UTSW	3	49754602	missense	possibly damaging	0.81
R9432:Pcdh18	UTSW	3	49745218	missense	probably damaging	0.96
R9547:Pcdh18	UTSW	3	49755057	missense	possibly damaging	0.79
R9567:Pcdh18	UTSW	3	49756435	missense	possibly damaging	0.95
R9622:Pcdh18	UTSW	3	49756780	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- ATACGAGTCCCAACTGCTGC -3'
(R):5'- CACGATGTCCTGGCTAAGAATC -3'

Sequencing Primer
(F):5'- CGCTCTCCGATATCTCAATGGG -3'
(R):5'- TCCTGGCTAAGAATCTGAAATACAGG -3'

Posted On

2022-10-06