Incidental Mutation 'R9687:Pcdh18'
ID 728893
Institutional Source Beutler Lab
Gene Symbol Pcdh18
Ensembl Gene ENSMUSG00000037892
Gene Name protocadherin 18
Synonyms PCDH68L
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 49697745-49711723 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49711036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 93 (D93V)
Ref Sequence ENSEMBL: ENSMUSP00000039245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]
AlphaFold Q8VHR0
Predicted Effect probably damaging
Transcript: ENSMUST00000035931
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: D93V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
CA 51 135 1.36e-1 SMART
CA 159 244 3.78e-20 SMART
CA 268 352 1.12e-22 SMART
CA 382 463 5.76e-25 SMART
CA 487 574 2.51e-25 SMART
CA 603 684 8e-3 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 988 1009 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191794
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892
AA Change: D93V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 51 135 6.6e-4 SMART
CA 159 244 1.9e-22 SMART
CA 268 352 5.6e-25 SMART
CA 382 463 2.7e-27 SMART
CA 487 574 1.2e-27 SMART
CA 603 684 3.9e-5 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194603
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Pcdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Pcdh18 APN 3 49,707,828 (GRCm39) missense probably damaging 1.00
IGL00639:Pcdh18 APN 3 49,710,065 (GRCm39) missense probably benign 0.34
IGL00954:Pcdh18 APN 3 49,710,838 (GRCm39) missense probably damaging 1.00
IGL01338:Pcdh18 APN 3 49,710,590 (GRCm39) missense probably damaging 1.00
IGL01339:Pcdh18 APN 3 49,710,247 (GRCm39) missense probably benign 0.35
IGL01687:Pcdh18 APN 3 49,707,982 (GRCm39) splice site probably benign
IGL01727:Pcdh18 APN 3 49,710,149 (GRCm39) missense probably damaging 0.99
IGL01788:Pcdh18 APN 3 49,710,371 (GRCm39) nonsense probably null
IGL01824:Pcdh18 APN 3 49,709,223 (GRCm39) missense probably damaging 1.00
IGL01834:Pcdh18 APN 3 49,711,279 (GRCm39) missense probably benign 0.03
IGL01913:Pcdh18 APN 3 49,709,698 (GRCm39) missense possibly damaging 0.94
IGL01915:Pcdh18 APN 3 49,699,370 (GRCm39) missense probably benign
IGL02095:Pcdh18 APN 3 49,710,605 (GRCm39) missense probably benign 0.01
IGL02128:Pcdh18 APN 3 49,711,135 (GRCm39) missense possibly damaging 0.65
IGL02302:Pcdh18 APN 3 49,710,387 (GRCm39) missense probably benign
IGL02342:Pcdh18 APN 3 49,710,493 (GRCm39) missense probably damaging 1.00
IGL02440:Pcdh18 APN 3 49,699,052 (GRCm39) utr 3 prime probably benign
IGL02499:Pcdh18 APN 3 49,707,896 (GRCm39) missense probably benign 0.15
IGL02570:Pcdh18 APN 3 49,711,074 (GRCm39) missense probably benign 0.02
IGL02745:Pcdh18 APN 3 49,710,340 (GRCm39) missense probably damaging 1.00
IGL03073:Pcdh18 APN 3 49,707,816 (GRCm39) missense possibly damaging 0.93
PIT4469001:Pcdh18 UTSW 3 49,709,518 (GRCm39) missense probably benign
R0078:Pcdh18 UTSW 3 49,710,793 (GRCm39) missense probably damaging 1.00
R0196:Pcdh18 UTSW 3 49,711,147 (GRCm39) splice site probably null
R0524:Pcdh18 UTSW 3 49,710,091 (GRCm39) missense probably damaging 0.98
R0661:Pcdh18 UTSW 3 49,707,767 (GRCm39) missense possibly damaging 0.64
R0900:Pcdh18 UTSW 3 49,711,252 (GRCm39) missense probably benign 0.25
R1101:Pcdh18 UTSW 3 49,707,828 (GRCm39) missense probably damaging 1.00
R1463:Pcdh18 UTSW 3 49,709,854 (GRCm39) missense probably damaging 0.99
R1778:Pcdh18 UTSW 3 49,710,083 (GRCm39) missense probably benign 0.19
R1850:Pcdh18 UTSW 3 49,710,854 (GRCm39) missense probably benign 0.22
R1875:Pcdh18 UTSW 3 49,709,154 (GRCm39) missense probably damaging 0.99
R1903:Pcdh18 UTSW 3 49,709,896 (GRCm39) missense probably benign
R1956:Pcdh18 UTSW 3 49,710,400 (GRCm39) missense probably benign
R2044:Pcdh18 UTSW 3 49,709,389 (GRCm39) missense probably benign
R2303:Pcdh18 UTSW 3 49,709,723 (GRCm39) missense probably damaging 1.00
R3732:Pcdh18 UTSW 3 49,709,240 (GRCm39) missense probably benign
R3732:Pcdh18 UTSW 3 49,709,240 (GRCm39) missense probably benign
R3733:Pcdh18 UTSW 3 49,709,240 (GRCm39) missense probably benign
R3973:Pcdh18 UTSW 3 49,709,035 (GRCm39) missense probably damaging 1.00
R4281:Pcdh18 UTSW 3 49,710,982 (GRCm39) missense possibly damaging 0.76
R4601:Pcdh18 UTSW 3 49,699,174 (GRCm39) missense probably damaging 1.00
R4631:Pcdh18 UTSW 3 49,710,890 (GRCm39) missense probably damaging 0.99
R4752:Pcdh18 UTSW 3 49,709,563 (GRCm39) missense probably damaging 1.00
R4840:Pcdh18 UTSW 3 49,699,117 (GRCm39) missense probably damaging 0.98
R4867:Pcdh18 UTSW 3 49,709,113 (GRCm39) missense probably damaging 1.00
R5007:Pcdh18 UTSW 3 49,708,906 (GRCm39) missense probably benign 0.23
R5039:Pcdh18 UTSW 3 49,709,305 (GRCm39) missense probably benign
R5169:Pcdh18 UTSW 3 49,710,415 (GRCm39) missense possibly damaging 0.65
R5438:Pcdh18 UTSW 3 49,710,465 (GRCm39) nonsense probably null
R5579:Pcdh18 UTSW 3 49,699,426 (GRCm39) missense probably damaging 1.00
R6000:Pcdh18 UTSW 3 49,708,913 (GRCm39) missense probably damaging 0.99
R6220:Pcdh18 UTSW 3 49,699,700 (GRCm39) missense probably damaging 1.00
R6737:Pcdh18 UTSW 3 49,710,344 (GRCm39) missense probably damaging 0.98
R6789:Pcdh18 UTSW 3 49,710,364 (GRCm39) missense probably benign 0.00
R7011:Pcdh18 UTSW 3 49,709,231 (GRCm39) missense probably benign
R7146:Pcdh18 UTSW 3 49,710,271 (GRCm39) missense probably damaging 1.00
R7150:Pcdh18 UTSW 3 49,709,143 (GRCm39) missense probably benign 0.31
R7205:Pcdh18 UTSW 3 49,709,923 (GRCm39) missense probably benign
R7326:Pcdh18 UTSW 3 49,711,309 (GRCm39) missense probably benign
R7413:Pcdh18 UTSW 3 49,699,232 (GRCm39) missense possibly damaging 0.94
R7755:Pcdh18 UTSW 3 49,709,278 (GRCm39) missense possibly damaging 0.59
R7848:Pcdh18 UTSW 3 49,710,446 (GRCm39) missense possibly damaging 0.54
R8169:Pcdh18 UTSW 3 49,699,684 (GRCm39) missense probably damaging 1.00
R8264:Pcdh18 UTSW 3 49,711,030 (GRCm39) missense probably damaging 1.00
R8352:Pcdh18 UTSW 3 49,699,624 (GRCm39) missense possibly damaging 0.81
R8406:Pcdh18 UTSW 3 49,710,998 (GRCm39) missense probably damaging 1.00
R8452:Pcdh18 UTSW 3 49,699,624 (GRCm39) missense possibly damaging 0.81
R8489:Pcdh18 UTSW 3 49,709,038 (GRCm39) missense probably damaging 1.00
R8526:Pcdh18 UTSW 3 49,710,023 (GRCm39) missense probably damaging 1.00
R9075:Pcdh18 UTSW 3 49,699,339 (GRCm39) missense probably benign
R9285:Pcdh18 UTSW 3 49,707,786 (GRCm39) missense probably damaging 0.97
R9316:Pcdh18 UTSW 3 49,709,089 (GRCm39) missense probably damaging 1.00
R9339:Pcdh18 UTSW 3 49,709,335 (GRCm39) missense probably damaging 1.00
R9410:Pcdh18 UTSW 3 49,699,615 (GRCm39) missense probably damaging 1.00
R9425:Pcdh18 UTSW 3 49,709,051 (GRCm39) missense possibly damaging 0.81
R9432:Pcdh18 UTSW 3 49,699,667 (GRCm39) missense probably damaging 0.96
R9547:Pcdh18 UTSW 3 49,709,506 (GRCm39) missense possibly damaging 0.79
R9567:Pcdh18 UTSW 3 49,710,884 (GRCm39) missense possibly damaging 0.95
R9622:Pcdh18 UTSW 3 49,711,229 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATACGAGTCCCAACTGCTGC -3'
(R):5'- CACGATGTCCTGGCTAAGAATC -3'

Sequencing Primer
(F):5'- CGCTCTCCGATATCTCAATGGG -3'
(R):5'- TCCTGGCTAAGAATCTGAAATACAGG -3'
Posted On 2022-10-06