Incidental Mutation 'R9687:Kif24'
ID 728896
Institutional Source Beutler Lab
Gene Symbol Kif24
Ensembl Gene ENSMUSG00000028438
Gene Name kinesin family member 24
Synonyms 4933425J19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 41390745-41464887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41428546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 138 (L138P)
Ref Sequence ENSEMBL: ENSMUSP00000103690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030148] [ENSMUST00000108055] [ENSMUST00000154535]
AlphaFold Q6NWW5
Predicted Effect probably damaging
Transcript: ENSMUST00000030148
AA Change: L138P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030148
Gene: ENSMUSG00000028438
AA Change: L138P

DomainStartEndE-ValueType
KISc 216 413 2.51e-29 SMART
low complexity region 481 499 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 626 644 N/A INTRINSIC
low complexity region 678 695 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108055
AA Change: L138P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103690
Gene: ENSMUSG00000028438
AA Change: L138P

DomainStartEndE-ValueType
Blast:KISc 82 205 1e-47 BLAST
KISc 216 547 3.09e-134 SMART
low complexity region 615 633 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 812 829 N/A INTRINSIC
low complexity region 1253 1264 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154535
AA Change: L138P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119009
Gene: ENSMUSG00000028438
AA Change: L138P

DomainStartEndE-ValueType
Pfam:SAM_1 2 62 6.3e-7 PFAM
Blast:KISc 82 142 2e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Kif24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif24 APN 4 41,413,826 (GRCm39) splice site probably null
IGL00787:Kif24 APN 4 41,397,583 (GRCm39) missense probably damaging 1.00
IGL01065:Kif24 APN 4 41,423,639 (GRCm39) unclassified probably benign
IGL01716:Kif24 APN 4 41,393,454 (GRCm39) missense probably benign 0.40
IGL01796:Kif24 APN 4 41,392,978 (GRCm39) unclassified probably benign
IGL02307:Kif24 APN 4 41,395,274 (GRCm39) missense probably benign 0.02
IGL03061:Kif24 APN 4 41,394,323 (GRCm39) missense possibly damaging 0.86
IGL03080:Kif24 APN 4 41,394,417 (GRCm39) missense probably benign 0.12
IGL03100:Kif24 APN 4 41,394,446 (GRCm39) missense possibly damaging 0.59
R0226:Kif24 UTSW 4 41,414,939 (GRCm39) nonsense probably null
R0345:Kif24 UTSW 4 41,428,413 (GRCm39) missense probably benign 0.01
R0365:Kif24 UTSW 4 41,428,731 (GRCm39) missense probably benign 0.06
R0366:Kif24 UTSW 4 41,428,717 (GRCm39) missense possibly damaging 0.77
R0579:Kif24 UTSW 4 41,393,706 (GRCm39) missense probably damaging 0.97
R0682:Kif24 UTSW 4 41,428,620 (GRCm39) missense probably benign 0.01
R1611:Kif24 UTSW 4 41,423,552 (GRCm39) missense probably benign 0.02
R1634:Kif24 UTSW 4 41,393,529 (GRCm39) missense probably benign 0.02
R1772:Kif24 UTSW 4 41,409,787 (GRCm39) missense probably damaging 1.00
R1997:Kif24 UTSW 4 41,392,904 (GRCm39) missense possibly damaging 0.92
R3833:Kif24 UTSW 4 41,395,064 (GRCm39) missense probably damaging 1.00
R3849:Kif24 UTSW 4 41,404,734 (GRCm39) missense probably damaging 1.00
R4356:Kif24 UTSW 4 41,413,827 (GRCm39) critical splice donor site probably null
R4357:Kif24 UTSW 4 41,413,827 (GRCm39) critical splice donor site probably null
R4358:Kif24 UTSW 4 41,413,827 (GRCm39) critical splice donor site probably null
R4359:Kif24 UTSW 4 41,413,827 (GRCm39) critical splice donor site probably null
R4406:Kif24 UTSW 4 41,393,954 (GRCm39) missense probably damaging 1.00
R4580:Kif24 UTSW 4 41,395,287 (GRCm39) missense probably damaging 1.00
R4756:Kif24 UTSW 4 41,397,545 (GRCm39) critical splice donor site probably null
R4921:Kif24 UTSW 4 41,394,329 (GRCm39) missense probably damaging 0.99
R4935:Kif24 UTSW 4 41,394,939 (GRCm39) missense probably damaging 0.99
R5288:Kif24 UTSW 4 41,395,373 (GRCm39) missense probably benign 0.09
R5398:Kif24 UTSW 4 41,394,401 (GRCm39) missense possibly damaging 0.50
R5885:Kif24 UTSW 4 41,423,463 (GRCm39) missense probably damaging 1.00
R5901:Kif24 UTSW 4 41,428,604 (GRCm39) missense probably damaging 1.00
R5919:Kif24 UTSW 4 41,394,477 (GRCm39) missense possibly damaging 0.62
R5945:Kif24 UTSW 4 41,428,670 (GRCm39) nonsense probably null
R6278:Kif24 UTSW 4 41,423,498 (GRCm39) missense probably damaging 1.00
R6291:Kif24 UTSW 4 41,413,959 (GRCm39) missense probably damaging 1.00
R6891:Kif24 UTSW 4 41,394,168 (GRCm39) missense probably benign 0.33
R7178:Kif24 UTSW 4 41,395,085 (GRCm39) missense probably benign 0.00
R7437:Kif24 UTSW 4 41,404,687 (GRCm39) missense possibly damaging 0.70
R7453:Kif24 UTSW 4 41,394,673 (GRCm39) missense possibly damaging 0.91
R7543:Kif24 UTSW 4 41,413,993 (GRCm39) nonsense probably null
R7548:Kif24 UTSW 4 41,423,601 (GRCm39) missense possibly damaging 0.57
R8167:Kif24 UTSW 4 41,392,957 (GRCm39) missense possibly damaging 0.87
R8305:Kif24 UTSW 4 41,428,825 (GRCm39) missense probably damaging 1.00
R8407:Kif24 UTSW 4 41,394,488 (GRCm39) missense probably benign 0.05
R8722:Kif24 UTSW 4 41,394,233 (GRCm39) missense probably benign
R8916:Kif24 UTSW 4 41,394,963 (GRCm39) missense probably benign 0.23
R9093:Kif24 UTSW 4 41,428,691 (GRCm39) missense probably benign
R9172:Kif24 UTSW 4 41,400,442 (GRCm39) missense probably benign 0.44
R9468:Kif24 UTSW 4 41,404,794 (GRCm39) missense probably damaging 1.00
Z1088:Kif24 UTSW 4 41,395,091 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGACACAAGAATGAGGAATTC -3'
(R):5'- ATCCCAGAGCATCCTCTTCAGG -3'

Sequencing Primer
(F):5'- TCCATAGTTATACCCTGACACATGAG -3'
(R):5'- GAGCATCCTCTTCAGGCAAGC -3'
Posted On 2022-10-06