Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Kif24'

728896

Institutional Source

Beutler Lab

Gene Symbol

Kif24

Ensembl Gene

ENSMUSG00000028438

Gene Name

kinesin family member 24

Synonyms

4933425J19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41390745-41464887 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41428546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 138 (L138P)

Ref Sequence

ENSEMBL: ENSMUSP00000103690 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030148] [ENSMUST00000108055] [ENSMUST00000154535]

AlphaFold

Q6NWW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000030148
AA Change: L138P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000030148
Gene: ENSMUSG00000028438
AA Change: L138P

Domain	Start	End	E-Value	Type
KISc	216	413	2.51e-29	SMART
low complexity region	481	499	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	626	644	N/A	INTRINSIC
low complexity region	678	695	N/A	INTRINSIC
low complexity region	1119	1130	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108055
AA Change: L138P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103690
Gene: ENSMUSG00000028438
AA Change: L138P

Domain	Start	End	E-Value	Type
Blast:KISc	82	205	1e-47	BLAST
KISc	216	547	3.09e-134	SMART
low complexity region	615	633	N/A	INTRINSIC
low complexity region	697	708	N/A	INTRINSIC
low complexity region	760	778	N/A	INTRINSIC
low complexity region	812	829	N/A	INTRINSIC
low complexity region	1253	1264	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000154535
AA Change: L138P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119009
Gene: ENSMUSG00000028438
AA Change: L138P

Domain	Start	End	E-Value	Type
Pfam:SAM_1	2	62	6.3e-7	PFAM
Blast:KISc	82	142	2e-20	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]).[supplied by OMIM, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Kif24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Kif24	APN	4	41413826	splice site	probably null
IGL00787:Kif24	APN	4	41397583	missense	probably damaging	1.00
IGL01065:Kif24	APN	4	41423639	unclassified	probably benign
IGL01716:Kif24	APN	4	41393454	missense	probably benign	0.40
IGL01796:Kif24	APN	4	41392978	unclassified	probably benign
IGL02307:Kif24	APN	4	41395274	missense	probably benign	0.02
IGL03061:Kif24	APN	4	41394323	missense	possibly damaging	0.86
IGL03080:Kif24	APN	4	41394417	missense	probably benign	0.12
IGL03100:Kif24	APN	4	41394446	missense	possibly damaging	0.59
R0226:Kif24	UTSW	4	41414939	nonsense	probably null
R0345:Kif24	UTSW	4	41428413	missense	probably benign	0.01
R0365:Kif24	UTSW	4	41428731	missense	probably benign	0.06
R0366:Kif24	UTSW	4	41428717	missense	possibly damaging	0.77
R0579:Kif24	UTSW	4	41393706	missense	probably damaging	0.97
R0682:Kif24	UTSW	4	41428620	missense	probably benign	0.01
R1611:Kif24	UTSW	4	41423552	missense	probably benign	0.02
R1634:Kif24	UTSW	4	41393529	missense	probably benign	0.02
R1772:Kif24	UTSW	4	41409787	missense	probably damaging	1.00
R1997:Kif24	UTSW	4	41392904	missense	possibly damaging	0.92
R3833:Kif24	UTSW	4	41395064	missense	probably damaging	1.00
R3849:Kif24	UTSW	4	41404734	missense	probably damaging	1.00
R4356:Kif24	UTSW	4	41413827	critical splice donor site	probably null
R4357:Kif24	UTSW	4	41413827	critical splice donor site	probably null
R4358:Kif24	UTSW	4	41413827	critical splice donor site	probably null
R4359:Kif24	UTSW	4	41413827	critical splice donor site	probably null
R4406:Kif24	UTSW	4	41393954	missense	probably damaging	1.00
R4580:Kif24	UTSW	4	41395287	missense	probably damaging	1.00
R4756:Kif24	UTSW	4	41397545	critical splice donor site	probably null
R4921:Kif24	UTSW	4	41394329	missense	probably damaging	0.99
R4935:Kif24	UTSW	4	41394939	missense	probably damaging	0.99
R5288:Kif24	UTSW	4	41395373	missense	probably benign	0.09
R5398:Kif24	UTSW	4	41394401	missense	possibly damaging	0.50
R5885:Kif24	UTSW	4	41423463	missense	probably damaging	1.00
R5901:Kif24	UTSW	4	41428604	missense	probably damaging	1.00
R5919:Kif24	UTSW	4	41394477	missense	possibly damaging	0.62
R5945:Kif24	UTSW	4	41428670	nonsense	probably null
R6278:Kif24	UTSW	4	41423498	missense	probably damaging	1.00
R6291:Kif24	UTSW	4	41413959	missense	probably damaging	1.00
R6891:Kif24	UTSW	4	41394168	missense	probably benign	0.33
R7178:Kif24	UTSW	4	41395085	missense	probably benign	0.00
R7437:Kif24	UTSW	4	41404687	missense	possibly damaging	0.70
R7453:Kif24	UTSW	4	41394673	missense	possibly damaging	0.91
R7543:Kif24	UTSW	4	41413993	nonsense	probably null
R7548:Kif24	UTSW	4	41423601	missense	possibly damaging	0.57
R8167:Kif24	UTSW	4	41392957	missense	possibly damaging	0.87
R8305:Kif24	UTSW	4	41428825	missense	probably damaging	1.00
R8407:Kif24	UTSW	4	41394488	missense	probably benign	0.05
R8722:Kif24	UTSW	4	41394233	missense	probably benign
R8916:Kif24	UTSW	4	41394963	missense	probably benign	0.23
R9093:Kif24	UTSW	4	41428691	missense	probably benign
R9172:Kif24	UTSW	4	41400442	missense	probably benign	0.44
R9468:Kif24	UTSW	4	41404794	missense	probably damaging	1.00
Z1088:Kif24	UTSW	4	41395091	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCTGACACAAGAATGAGGAATTC -3'
(R):5'- ATCCCAGAGCATCCTCTTCAGG -3'

Sequencing Primer
(F):5'- TCCATAGTTATACCCTGACACATGAG -3'
(R):5'- GAGCATCCTCTTCAGGCAAGC -3'

Posted On

2022-10-06