Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Arhgap24'

728903

Institutional Source

Beutler Lab

Gene Symbol

Arhgap24

Ensembl Gene

ENSMUSG00000057315

Gene Name

Rho GTPase activating protein 24

Synonyms

0610025G21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102481391-102897937 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102846156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 34 (F34L)

Ref Sequence

ENSEMBL: ENSMUSP00000070048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070000
AA Change: F34L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: F34L

Domain	Start	End	E-Value	Type
RhoGAP	58	234	7.04e-67	SMART
low complexity region	476	487	N/A	INTRINSIC
low complexity region	520	539	N/A	INTRINSIC
coiled coil region	558	638	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000073302

SMART Domains

Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	38	5e-16	BLAST
RhoGAP	55	231	7.04e-67	SMART
low complexity region	473	484	N/A	INTRINSIC
low complexity region	517	536	N/A	INTRINSIC
coiled coil region	555	635	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094559

SMART Domains

Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315

Domain	Start	End	E-Value	Type
PH	18	125	5.35e-23	SMART
RhoGAP	148	324	7.04e-67	SMART
low complexity region	566	577	N/A	INTRINSIC
low complexity region	610	629	N/A	INTRINSIC
coiled coil region	648	728	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112852

SMART Domains

Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	38	5e-16	BLAST
RhoGAP	55	231	7.04e-67	SMART
low complexity region	473	484	N/A	INTRINSIC
low complexity region	517	536	N/A	INTRINSIC
coiled coil region	555	635	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112853

SMART Domains

Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	38	5e-16	BLAST
RhoGAP	55	231	7.04e-67	SMART
low complexity region	473	484	N/A	INTRINSIC
low complexity region	517	536	N/A	INTRINSIC
coiled coil region	555	635	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112854

SMART Domains

Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	38	5e-16	BLAST
RhoGAP	55	231	7.04e-67	SMART
low complexity region	473	484	N/A	INTRINSIC
low complexity region	517	536	N/A	INTRINSIC
coiled coil region	555	635	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Arhgap24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Arhgap24	APN	5	102860399	missense	possibly damaging	0.94
IGL01483:Arhgap24	APN	5	102860377	missense	possibly damaging	0.91
IGL02641:Arhgap24	APN	5	102892520	missense	probably damaging	1.00
IGL03166:Arhgap24	APN	5	102875686	splice site	probably benign
bullmarket	UTSW	5	102875777	missense	probably damaging	0.99
buyers	UTSW	5	102897220	missense	probably damaging	1.00
wallstreet	UTSW	5	102552297	splice site	probably null
BB009:Arhgap24	UTSW	5	102845969	intron	probably benign
BB019:Arhgap24	UTSW	5	102845969	intron	probably benign
R0506:Arhgap24	UTSW	5	102875777	missense	probably damaging	0.99
R0606:Arhgap24	UTSW	5	102897220	missense	probably damaging	1.00
R1457:Arhgap24	UTSW	5	102664106	missense	probably damaging	0.98
R1491:Arhgap24	UTSW	5	102860332	missense	possibly damaging	0.47
R1707:Arhgap24	UTSW	5	102892087	missense	probably benign	0.40
R2112:Arhgap24	UTSW	5	102892500	missense	probably damaging	1.00
R2300:Arhgap24	UTSW	5	102860425	missense	probably damaging	1.00
R2516:Arhgap24	UTSW	5	102891910	missense	probably benign
R3803:Arhgap24	UTSW	5	102892442	missense	probably damaging	0.98
R4257:Arhgap24	UTSW	5	102664117	missense	probably benign	0.00
R4761:Arhgap24	UTSW	5	102664214	intron	probably benign
R5045:Arhgap24	UTSW	5	102891877	missense	possibly damaging	0.79
R5121:Arhgap24	UTSW	5	102841335	missense	probably damaging	1.00
R5209:Arhgap24	UTSW	5	102892149	missense	probably benign	0.12
R5667:Arhgap24	UTSW	5	102846171	critical splice donor site	probably null
R5914:Arhgap24	UTSW	5	102552159	splice site	probably null
R6039:Arhgap24	UTSW	5	102880786	missense	probably damaging	0.98
R6039:Arhgap24	UTSW	5	102880786	missense	probably damaging	0.98
R6158:Arhgap24	UTSW	5	102892912	missense	probably benign	0.12
R6410:Arhgap24	UTSW	5	102892151	missense	probably benign	0.10
R6450:Arhgap24	UTSW	5	102897124	missense	probably benign	0.01
R6520:Arhgap24	UTSW	5	102880793	missense	probably benign	0.00
R6666:Arhgap24	UTSW	5	102552297	splice site	probably null
R7233:Arhgap24	UTSW	5	102878501	missense	probably benign	0.03
R7311:Arhgap24	UTSW	5	102892685	missense	probably damaging	1.00
R7460:Arhgap24	UTSW	5	102892346	missense	probably benign	0.36
R7483:Arhgap24	UTSW	5	102841308	missense	probably benign	0.13
R7515:Arhgap24	UTSW	5	102846016	intron	probably benign
R7667:Arhgap24	UTSW	5	102878457	missense	probably benign
R7932:Arhgap24	UTSW	5	102845969	intron	probably benign
R8227:Arhgap24	UTSW	5	102875781	missense	probably benign	0.02
R8289:Arhgap24	UTSW	5	102880826	missense	possibly damaging	0.88
R8431:Arhgap24	UTSW	5	102892598	missense	possibly damaging	0.49
R8721:Arhgap24	UTSW	5	102875699	missense	possibly damaging	0.46
R8767:Arhgap24	UTSW	5	102891874	missense	probably benign
R8954:Arhgap24	UTSW	5	102892270	missense	probably benign	0.00
R9120:Arhgap24	UTSW	5	102892150	missense	probably benign	0.05
R9306:Arhgap24	UTSW	5	102846142	missense	possibly damaging	0.91
Z1176:Arhgap24	UTSW	5	102875759	missense	probably damaging	0.97
Z1176:Arhgap24	UTSW	5	102880807	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCCCGGAGTTCTAGGAATC -3'
(R):5'- TCCCTGTCAGTCAAGGATCC -3'

Sequencing Primer
(F):5'- CGGAGTTCTAGGAATCAGCACTTC -3'
(R):5'- ATGGGTCTGAAAGCTTCC -3'

Posted On

2022-10-06