Incidental Mutation 'R9687:Myo1h'
ID 728904
Institutional Source Beutler Lab
Gene Symbol Myo1h
Ensembl Gene ENSMUSG00000066952
Gene Name myosin 1H
Synonyms 4631401O15Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114427314-114502637 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114458769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 184 (D184V)
Ref Sequence ENSEMBL: ENSMUSP00000132905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124316] [ENSMUST00000169347] [ENSMUST00000202006]
AlphaFold Q9D6A1
Predicted Effect probably damaging
Transcript: ENSMUST00000124316
AA Change: D168V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952
AA Change: D168V

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952
AA Change: D184V

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952
AA Change: D168V

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Meta Mutation Damage Score 0.5719 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Myo1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myo1h APN 5 114,453,132 (GRCm39) splice site probably benign
IGL00922:Myo1h APN 5 114,498,546 (GRCm39) missense probably damaging 1.00
IGL01022:Myo1h APN 5 114,474,361 (GRCm39) missense possibly damaging 0.67
IGL01364:Myo1h APN 5 114,486,500 (GRCm39) missense probably damaging 1.00
IGL01469:Myo1h APN 5 114,499,330 (GRCm39) missense probably damaging 1.00
IGL01626:Myo1h APN 5 114,453,027 (GRCm39) missense probably damaging 1.00
IGL02026:Myo1h APN 5 114,461,505 (GRCm39) missense probably null 0.07
IGL02156:Myo1h APN 5 114,491,972 (GRCm39) splice site probably benign
IGL02164:Myo1h APN 5 114,472,157 (GRCm39) missense probably damaging 1.00
IGL02429:Myo1h APN 5 114,497,799 (GRCm39) splice site probably benign
IGL02562:Myo1h APN 5 114,496,053 (GRCm39) missense probably benign 0.06
IGL02938:Myo1h APN 5 114,497,000 (GRCm39) missense probably damaging 1.00
R0056:Myo1h UTSW 5 114,468,273 (GRCm39) missense probably damaging 1.00
R0172:Myo1h UTSW 5 114,467,225 (GRCm39) splice site probably null
R0346:Myo1h UTSW 5 114,493,270 (GRCm39) missense probably benign 0.19
R0464:Myo1h UTSW 5 114,498,571 (GRCm39) missense probably damaging 1.00
R0556:Myo1h UTSW 5 114,457,852 (GRCm39) missense probably damaging 1.00
R0723:Myo1h UTSW 5 114,457,741 (GRCm39) missense probably benign 0.20
R0751:Myo1h UTSW 5 114,458,747 (GRCm39) missense probably damaging 1.00
R1470:Myo1h UTSW 5 114,457,765 (GRCm39) missense probably damaging 0.99
R1470:Myo1h UTSW 5 114,457,765 (GRCm39) missense probably damaging 0.99
R1579:Myo1h UTSW 5 114,485,496 (GRCm39) nonsense probably null
R1646:Myo1h UTSW 5 114,455,693 (GRCm39) missense possibly damaging 0.90
R1648:Myo1h UTSW 5 114,474,336 (GRCm39) missense probably damaging 1.00
R1981:Myo1h UTSW 5 114,491,898 (GRCm39) missense probably damaging 1.00
R2006:Myo1h UTSW 5 114,499,140 (GRCm39) missense probably damaging 1.00
R2697:Myo1h UTSW 5 114,493,274 (GRCm39) missense probably damaging 1.00
R3124:Myo1h UTSW 5 114,466,860 (GRCm39) missense probably benign 0.04
R3195:Myo1h UTSW 5 114,466,801 (GRCm39) missense probably benign
R4255:Myo1h UTSW 5 114,468,198 (GRCm39) missense possibly damaging 0.89
R4613:Myo1h UTSW 5 114,489,737 (GRCm39) missense probably benign 0.02
R4613:Myo1h UTSW 5 114,486,440 (GRCm39) missense possibly damaging 0.73
R4758:Myo1h UTSW 5 114,487,643 (GRCm39) missense probably damaging 1.00
R4784:Myo1h UTSW 5 114,498,660 (GRCm39) missense possibly damaging 0.46
R4785:Myo1h UTSW 5 114,498,660 (GRCm39) missense possibly damaging 0.46
R5511:Myo1h UTSW 5 114,483,958 (GRCm39) nonsense probably null
R5663:Myo1h UTSW 5 114,472,155 (GRCm39) missense probably damaging 1.00
R6186:Myo1h UTSW 5 114,457,864 (GRCm39) missense possibly damaging 0.90
R6243:Myo1h UTSW 5 114,500,208 (GRCm39) missense probably damaging 1.00
R6344:Myo1h UTSW 5 114,466,776 (GRCm39) missense probably damaging 1.00
R6345:Myo1h UTSW 5 114,489,769 (GRCm39) missense probably damaging 1.00
R6383:Myo1h UTSW 5 114,474,325 (GRCm39) missense probably damaging 1.00
R6444:Myo1h UTSW 5 114,453,017 (GRCm39) missense possibly damaging 0.63
R6787:Myo1h UTSW 5 114,458,714 (GRCm39) missense probably damaging 1.00
R6891:Myo1h UTSW 5 114,487,673 (GRCm39) missense probably damaging 1.00
R6990:Myo1h UTSW 5 114,468,221 (GRCm39) missense probably damaging 0.97
R7040:Myo1h UTSW 5 114,497,805 (GRCm39) missense possibly damaging 0.67
R7101:Myo1h UTSW 5 114,480,258 (GRCm39) missense
R7121:Myo1h UTSW 5 114,476,290 (GRCm39) missense
R7206:Myo1h UTSW 5 114,457,836 (GRCm39) nonsense probably null
R7222:Myo1h UTSW 5 114,493,322 (GRCm39) critical splice donor site probably null
R7838:Myo1h UTSW 5 114,466,872 (GRCm39) splice site probably null
R7896:Myo1h UTSW 5 114,474,372 (GRCm39) splice site probably null
R8004:Myo1h UTSW 5 114,458,769 (GRCm39) missense
R8323:Myo1h UTSW 5 114,480,200 (GRCm39) missense
R8874:Myo1h UTSW 5 114,472,163 (GRCm39) missense
R8945:Myo1h UTSW 5 114,470,784 (GRCm39) missense probably damaging 1.00
R9432:Myo1h UTSW 5 114,499,366 (GRCm39) missense possibly damaging 0.92
R9518:Myo1h UTSW 5 114,497,588 (GRCm39) missense probably damaging 0.99
R9527:Myo1h UTSW 5 114,453,098 (GRCm39) missense
R9548:Myo1h UTSW 5 114,499,154 (GRCm39) missense probably benign 0.16
R9803:Myo1h UTSW 5 114,483,997 (GRCm39) missense
Z1177:Myo1h UTSW 5 114,472,217 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GACAATGTGTGGCTTCCCTC -3'
(R):5'- ACACTACATGCTCATGAATGCAG -3'

Sequencing Primer
(F):5'- AATGTGTGGCTTCCCTCCCTAG -3'
(R):5'- TGCTCATGAATGCAGCCATATGC -3'
Posted On 2022-10-06