Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Ppp1r9a'

728905

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r9a

Ensembl Gene

ENSMUSG00000032827

Gene Name

protein phosphatase 1, regulatory (inhibitor) subunit 9A

Synonyms

A230094E16Rik, Neurabin I, 2810430P21Rik, neurabin-I, NRB, 4930518N04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.533) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4902917-5165661 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4905978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 178 (S178P)

Ref Sequence

ENSEMBL: ENSMUSP00000135629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000168998] [ENSMUST00000175889] [ENSMUST00000175962] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177338] [ENSMUST00000177456]

AlphaFold

H3BJD6

Predicted Effect

probably damaging
Transcript: ENSMUST00000035813
AA Change: S178P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: S178P

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	5e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
SAM	986	1052	6.41e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168998
AA Change: S178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126643
Gene: ENSMUSG00000032827
AA Change: S178P

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175889
AA Change: S178P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: S178P

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
SAM	986	1041	1.72e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000175962
AA Change: S178P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135360
Gene: ENSMUSG00000032827
AA Change: S178P

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDB:3HVQ\|D	436	466	3e-12	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000176263
AA Change: S178P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: S178P

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
low complexity region	643	649	N/A	INTRINSIC
Blast:PDZ	763	800	2e-15	BLAST
low complexity region	806	820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176729

SMART Domains

Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	96	115	N/A	INTRINSIC
PDB:3HVQ\|D	116	232	4e-79	PDB
SCOP:d1be9a_	174	232	5e-9	SMART
Blast:PDZ	193	232	1e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000177153
AA Change: S178P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: S178P

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177338
AA Change: S178P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135634
Gene: ENSMUSG00000032827
AA Change: S178P

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177456
AA Change: S178P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: S178P

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
low complexity region	966	987	N/A	INTRINSIC
low complexity region	1040	1049	N/A	INTRINSIC
low complexity region	1103	1114	N/A	INTRINSIC
SAM	1183	1249	6.41e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Ppp1r9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Ppp1r9a	APN	6	5158195	missense	possibly damaging	0.72
IGL00796:Ppp1r9a	APN	6	5157014	missense	probably benign	0.37
IGL00906:Ppp1r9a	APN	6	5157023	missense	possibly damaging	0.62
IGL01662:Ppp1r9a	APN	6	5115322	missense	probably damaging	1.00
IGL01695:Ppp1r9a	APN	6	5064003	missense	probably damaging	1.00
IGL01807:Ppp1r9a	APN	6	5158248	nonsense	probably null
IGL02126:Ppp1r9a	APN	6	5156229	missense	probably damaging	1.00
IGL02423:Ppp1r9a	APN	6	4906537	missense	probably benign	0.25
IGL03343:Ppp1r9a	APN	6	5046015	missense	probably damaging	1.00
IGL03365:Ppp1r9a	APN	6	5110993	splice site	probably benign
R0545:Ppp1r9a	UTSW	6	5115357	missense	probably benign	0.45
R1126:Ppp1r9a	UTSW	6	4906795	missense	possibly damaging	0.93
R1137:Ppp1r9a	UTSW	6	5159697	missense	possibly damaging	0.46
R1443:Ppp1r9a	UTSW	6	5057557	missense	probably damaging	1.00
R1484:Ppp1r9a	UTSW	6	5113712	nonsense	probably null
R1545:Ppp1r9a	UTSW	6	5156242	critical splice donor site	probably null
R1627:Ppp1r9a	UTSW	6	4906168	missense	possibly damaging	0.50
R1672:Ppp1r9a	UTSW	6	5143491	critical splice donor site	probably null
R1826:Ppp1r9a	UTSW	6	5111060	splice site	probably benign
R1834:Ppp1r9a	UTSW	6	5113710	missense	probably damaging	0.98
R1874:Ppp1r9a	UTSW	6	4906348	missense	possibly damaging	0.87
R2224:Ppp1r9a	UTSW	6	5154074	missense	probably benign
R2227:Ppp1r9a	UTSW	6	5154074	missense	probably benign
R2898:Ppp1r9a	UTSW	6	4906558	missense	probably benign	0.01
R3606:Ppp1r9a	UTSW	6	5113674	missense	possibly damaging	0.90
R3732:Ppp1r9a	UTSW	6	4906259	unclassified	probably benign
R3927:Ppp1r9a	UTSW	6	5057531	missense	probably damaging	1.00
R4631:Ppp1r9a	UTSW	6	4906537	missense	possibly damaging	0.62
R4682:Ppp1r9a	UTSW	6	4905477	missense	possibly damaging	0.48
R4766:Ppp1r9a	UTSW	6	5157016	missense	probably benign	0.11
R5197:Ppp1r9a	UTSW	6	5156177	missense	probably damaging	1.00
R5217:Ppp1r9a	UTSW	6	5115367	missense	probably damaging	1.00
R5493:Ppp1r9a	UTSW	6	5159702	missense	probably damaging	0.99
R5790:Ppp1r9a	UTSW	6	5134363	intron	probably benign
R5828:Ppp1r9a	UTSW	6	5158200	missense	probably damaging	1.00
R5896:Ppp1r9a	UTSW	6	5159648	missense	probably damaging	1.00
R5930:Ppp1r9a	UTSW	6	5157002	critical splice acceptor site	probably null
R5990:Ppp1r9a	UTSW	6	5134660	missense	probably benign	0.05
R6017:Ppp1r9a	UTSW	6	4906363	missense	probably benign	0.18
R6122:Ppp1r9a	UTSW	6	4905509	missense	probably damaging	1.00
R6164:Ppp1r9a	UTSW	6	5110715	intron	probably benign
R6175:Ppp1r9a	UTSW	6	4905639	nonsense	probably null
R6188:Ppp1r9a	UTSW	6	5158113	nonsense	probably null
R6233:Ppp1r9a	UTSW	6	5077610	missense	probably damaging	1.00
R6321:Ppp1r9a	UTSW	6	5115151	missense	probably damaging	1.00
R6449:Ppp1r9a	UTSW	6	5057458	missense	probably benign	0.44
R6454:Ppp1r9a	UTSW	6	4905827	missense	probably damaging	1.00
R6527:Ppp1r9a	UTSW	6	5045949	missense	probably damaging	1.00
R7053:Ppp1r9a	UTSW	6	4905670	missense	probably damaging	1.00
R7233:Ppp1r9a	UTSW	6	5134804	missense	probably benign
R7238:Ppp1r9a	UTSW	6	5159716	missense	probably damaging	1.00
R7438:Ppp1r9a	UTSW	6	5115378	missense	probably damaging	0.99
R7497:Ppp1r9a	UTSW	6	4905775	missense	probably damaging	1.00
R7666:Ppp1r9a	UTSW	6	5143238	missense	probably benign	0.00
R7698:Ppp1r9a	UTSW	6	4906430	missense	probably benign
R7850:Ppp1r9a	UTSW	6	4905894	missense	possibly damaging	0.77
R8029:Ppp1r9a	UTSW	6	5057518	missense	possibly damaging	0.76
R8392:Ppp1r9a	UTSW	6	5143491	critical splice donor site	probably null
R8411:Ppp1r9a	UTSW	6	5057568	missense	probably damaging	1.00
R8431:Ppp1r9a	UTSW	6	5115456	missense	probably benign	0.01
R8699:Ppp1r9a	UTSW	6	5115474	missense	probably benign	0.00
R8708:Ppp1r9a	UTSW	6	5115196	missense	probably damaging	1.00
R9039:Ppp1r9a	UTSW	6	5134657	missense	probably benign	0.00
R9096:Ppp1r9a	UTSW	6	4906012	missense	probably damaging	1.00
R9097:Ppp1r9a	UTSW	6	4906012	missense	probably damaging	1.00
R9131:Ppp1r9a	UTSW	6	5134106	missense	possibly damaging	0.86
R9279:Ppp1r9a	UTSW	6	5113757	missense	probably damaging	1.00
R9512:Ppp1r9a	UTSW	6	5113681	missense	probably benign	0.27
R9512:Ppp1r9a	UTSW	6	5115364	missense	probably damaging	0.99
R9567:Ppp1r9a	UTSW	6	5157004	missense	probably benign	0.34
R9672:Ppp1r9a	UTSW	6	5007889	missense	unknown
R9715:Ppp1r9a	UTSW	6	5045936	missense	probably damaging	0.96
RF007:Ppp1r9a	UTSW	6	4906657	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGAGTCCTCTGTCTCTGAAC -3'
(R):5'- AGGTATCCAGATTGGTGACGG -3'

Sequencing Primer
(F):5'- GGAGTCCTCTGTCTCTGAACGAATC -3'
(R):5'- TATCCAGATTGGTGACGGTAACAG -3'

Posted On

2022-10-06