Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Gcfc2'

728908

Institutional Source

Beutler Lab

Gene Symbol

Gcfc2

Ensembl Gene

ENSMUSG00000035125

Gene Name

GC-rich sequence DNA binding factor 2

Synonyms

AW146020

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.435) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81923669-81959915 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81941342 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 338 (S338T)

Ref Sequence

ENSEMBL: ENSMUSP00000035644 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]

AlphaFold

Q8BKT3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043195
AA Change: S338T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: S338T

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC
coiled coil region	255	308	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
Pfam:GCFC	456	672	3e-34	PFAM
low complexity region	753	763	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152996

SMART Domains

Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Gcfc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Gcfc2	APN	6	81936015	missense	probably damaging	0.99
IGL00473:Gcfc2	APN	6	81944374	missense	probably damaging	1.00
IGL00497:Gcfc2	APN	6	81957970	missense	probably benign	0.08
IGL02135:Gcfc2	APN	6	81941400	missense	probably damaging	1.00
R0138:Gcfc2	UTSW	6	81949954	missense	probably damaging	1.00
R0208:Gcfc2	UTSW	6	81943463	missense	probably null	0.91
R0467:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R1105:Gcfc2	UTSW	6	81939453	missense	probably damaging	1.00
R1521:Gcfc2	UTSW	6	81923812	missense	probably benign	0.14
R1602:Gcfc2	UTSW	6	81944420	missense	probably damaging	1.00
R1846:Gcfc2	UTSW	6	81956892	missense	probably damaging	0.99
R2091:Gcfc2	UTSW	6	81943479	missense	probably damaging	1.00
R2110:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2111:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2112:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2892:Gcfc2	UTSW	6	81956913	missense	possibly damaging	0.87
R3792:Gcfc2	UTSW	6	81930767	missense	probably benign	0.00
R4284:Gcfc2	UTSW	6	81941391	missense	probably damaging	1.00
R4304:Gcfc2	UTSW	6	81943007	missense	probably damaging	1.00
R4691:Gcfc2	UTSW	6	81941427	nonsense	probably null
R5046:Gcfc2	UTSW	6	81948335	missense	probably benign	0.12
R5233:Gcfc2	UTSW	6	81953290	missense	probably damaging	1.00
R5307:Gcfc2	UTSW	6	81944386	missense	probably damaging	0.97
R5308:Gcfc2	UTSW	6	81943543	critical splice donor site	probably null
R5929:Gcfc2	UTSW	6	81946599	missense	probably damaging	1.00
R6339:Gcfc2	UTSW	6	81946496	missense	probably damaging	1.00
R6485:Gcfc2	UTSW	6	81939547	missense	probably damaging	1.00
R6931:Gcfc2	UTSW	6	81942985	missense	probably benign	0.36
R6948:Gcfc2	UTSW	6	81933753	missense	probably benign	0.01
R7392:Gcfc2	UTSW	6	81943012	critical splice donor site	probably null
R7423:Gcfc2	UTSW	6	81946560	missense	probably damaging	1.00
R7509:Gcfc2	UTSW	6	81953275	missense	probably damaging	1.00
R7713:Gcfc2	UTSW	6	81941390	missense	probably damaging	1.00
R8089:Gcfc2	UTSW	6	81925790	missense	probably damaging	1.00
R8249:Gcfc2	UTSW	6	81956951	missense	probably benign	0.02
R8366:Gcfc2	UTSW	6	81923801	missense	probably benign	0.05
R8553:Gcfc2	UTSW	6	81935963	missense	probably benign	0.01
R8560:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R8779:Gcfc2	UTSW	6	81948317	missense	probably benign	0.00
R8915:Gcfc2	UTSW	6	81941366	missense	probably benign	0.36
R8924:Gcfc2	UTSW	6	81932898	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCGCAAGCACATTCTCCTCA -3'
(R):5'- TGCGGGGTAAAGGATTAATGT -3'

Sequencing Primer
(F):5'- AGCACATTCTCCTCACCCCATATC -3'
(R):5'- TCCACGGTTCTATTAGAAAGCAGGC -3'

Posted On

2022-10-06