Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Tubgcp5'

728911

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp5

Ensembl Gene

ENSMUSG00000033790

Gene Name

tubulin, gamma complex associated protein 5

Synonyms

B130010C12Rik, GCP5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55794154-55831677 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

G to T at 55825579 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206133] [ENSMUST00000206191]

AlphaFold

Q8BKN5

Predicted Effect

probably null
Transcript: ENSMUST00000032627

SMART Domains

Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790

Domain	Start	End	E-Value	Type
low complexity region	109	124	N/A	INTRINSIC
Pfam:Spc97_Spc98	273	942	1.2e-126	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000032627

SMART Domains

Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790

Domain	Start	End	E-Value	Type
low complexity region	109	124	N/A	INTRINSIC
Pfam:Spc97_Spc98	273	942	1.2e-126	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205796

Predicted Effect

probably benign
Transcript: ENSMUST00000206133

Predicted Effect

probably benign
Transcript: ENSMUST00000206191

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Tubgcp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Tubgcp5	APN	7	55806595	missense	possibly damaging	0.91
IGL01291:Tubgcp5	APN	7	55808529	missense	possibly damaging	0.83
IGL01343:Tubgcp5	APN	7	55796031	splice site	probably benign
IGL01597:Tubgcp5	APN	7	55806832	splice site	probably benign
IGL01688:Tubgcp5	APN	7	55815018	missense	possibly damaging	0.92
IGL01843:Tubgcp5	APN	7	55799473	missense	probably benign	0.02
IGL01950:Tubgcp5	APN	7	55806088	missense	possibly damaging	0.93
IGL01957:Tubgcp5	APN	7	55818757	missense	probably damaging	1.00
IGL02902:Tubgcp5	APN	7	55806607	nonsense	probably null
IGL03105:Tubgcp5	APN	7	55825581	missense	probably damaging	1.00
ANU05:Tubgcp5	UTSW	7	55808529	missense	possibly damaging	0.83
R0078:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R0322:Tubgcp5	UTSW	7	55814978	missense	probably damaging	0.98
R0362:Tubgcp5	UTSW	7	55800684	missense	probably damaging	1.00
R0449:Tubgcp5	UTSW	7	55823567	missense	probably benign
R0488:Tubgcp5	UTSW	7	55829338	missense	probably damaging	0.96
R0853:Tubgcp5	UTSW	7	55814851	splice site	probably benign
R0885:Tubgcp5	UTSW	7	55806055	nonsense	probably null
R1483:Tubgcp5	UTSW	7	55825707	critical splice donor site	probably null
R1746:Tubgcp5	UTSW	7	55808537	missense	probably benign	0.05
R1766:Tubgcp5	UTSW	7	55815020	missense	probably benign	0.15
R2148:Tubgcp5	UTSW	7	55799511	missense	probably damaging	1.00
R2229:Tubgcp5	UTSW	7	55830881	missense	probably damaging	1.00
R3766:Tubgcp5	UTSW	7	55830866	missense	probably damaging	0.98
R4154:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R4838:Tubgcp5	UTSW	7	55794185	unclassified	probably benign
R4948:Tubgcp5	UTSW	7	55806123	missense	probably benign	0.00
R5110:Tubgcp5	UTSW	7	55808637	missense	probably damaging	0.96
R5347:Tubgcp5	UTSW	7	55823685	missense	probably damaging	1.00
R5417:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R5574:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R5758:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R5957:Tubgcp5	UTSW	7	55814962	missense	probably benign	0.03
R6014:Tubgcp5	UTSW	7	55823609	missense	probably benign
R6141:Tubgcp5	UTSW	7	55806778	missense	probably benign	0.30
R6289:Tubgcp5	UTSW	7	55795923	missense	probably benign	0.05
R6511:Tubgcp5	UTSW	7	55817392	nonsense	probably null
R6563:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R6574:Tubgcp5	UTSW	7	55823583	missense	probably benign
R6596:Tubgcp5	UTSW	7	55806634	missense	probably benign	0.38
R7016:Tubgcp5	UTSW	7	55794229	missense	possibly damaging	0.76
R7038:Tubgcp5	UTSW	7	55805366	missense	probably damaging	0.99
R7075:Tubgcp5	UTSW	7	55829407	missense	probably benign	0.04
R7083:Tubgcp5	UTSW	7	55800695	nonsense	probably null
R7213:Tubgcp5	UTSW	7	55806112	missense	probably damaging	0.97
R7284:Tubgcp5	UTSW	7	55823567	missense	probably benign
R7600:Tubgcp5	UTSW	7	55808513	missense	probably benign
R7813:Tubgcp5	UTSW	7	55800696	missense	possibly damaging	0.49
R7920:Tubgcp5	UTSW	7	55816562	missense	probably benign	0.00
R7948:Tubgcp5	UTSW	7	55794248	missense	probably benign	0.01
R8438:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R8499:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R9087:Tubgcp5	UTSW	7	55817358	missense	probably damaging	1.00
R9211:Tubgcp5	UTSW	7	55806583	missense	probably benign	0.05
R9269:Tubgcp5	UTSW	7	55795945	missense	possibly damaging	0.94
R9329:Tubgcp5	UTSW	7	55829433	critical splice donor site	probably null
R9355:Tubgcp5	UTSW	7	55817429	critical splice donor site	probably null
R9498:Tubgcp5	UTSW	7	55813485	missense	possibly damaging	0.46
Z1088:Tubgcp5	UTSW	7	55815101	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCATTGTCTAGGGCTCAG -3'
(R):5'- GCTACATGCCTAGATACCGTC -3'

Sequencing Primer
(F):5'- CCAGCCTGGTCTATAAAGTGAGTTC -3'
(R):5'- ACATGCCTAGATACCGTCTTTCC -3'

Posted On

2022-10-06