Incidental Mutation 'R9687:Tubgcp5'
ID 728911
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Name tubulin, gamma complex component 5
Synonyms GCP5, B130010C12Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 55443873-55481207 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to T at 55475327 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206133] [ENSMUST00000206191]
AlphaFold Q8BKN5
Predicted Effect probably null
Transcript: ENSMUST00000032627
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000032627
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205796
Predicted Effect probably benign
Transcript: ENSMUST00000206133
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55,456,343 (GRCm39) missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55,458,277 (GRCm39) missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55,445,779 (GRCm39) splice site probably benign
IGL01597:Tubgcp5 APN 7 55,456,580 (GRCm39) splice site probably benign
IGL01688:Tubgcp5 APN 7 55,464,766 (GRCm39) missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55,449,221 (GRCm39) missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55,455,836 (GRCm39) missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55,468,505 (GRCm39) missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55,456,355 (GRCm39) nonsense probably null
IGL03105:Tubgcp5 APN 7 55,475,329 (GRCm39) missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55,458,277 (GRCm39) missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55,468,643 (GRCm39) missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55,464,726 (GRCm39) missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55,450,432 (GRCm39) missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55,473,315 (GRCm39) missense probably benign
R0488:Tubgcp5 UTSW 7 55,479,086 (GRCm39) missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55,464,599 (GRCm39) splice site probably benign
R0885:Tubgcp5 UTSW 7 55,455,803 (GRCm39) nonsense probably null
R1483:Tubgcp5 UTSW 7 55,475,455 (GRCm39) critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55,458,285 (GRCm39) missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55,464,768 (GRCm39) missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55,449,259 (GRCm39) missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55,480,629 (GRCm39) missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55,480,614 (GRCm39) missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55,455,077 (GRCm39) missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55,443,933 (GRCm39) unclassified probably benign
R4948:Tubgcp5 UTSW 7 55,455,871 (GRCm39) missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55,458,385 (GRCm39) missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55,473,433 (GRCm39) missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55,475,409 (GRCm39) missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55,455,077 (GRCm39) missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55,468,643 (GRCm39) missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55,464,710 (GRCm39) missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55,473,357 (GRCm39) missense probably benign
R6141:Tubgcp5 UTSW 7 55,456,526 (GRCm39) missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55,445,671 (GRCm39) missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55,467,140 (GRCm39) nonsense probably null
R6563:Tubgcp5 UTSW 7 55,475,409 (GRCm39) missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55,473,331 (GRCm39) missense probably benign
R6596:Tubgcp5 UTSW 7 55,456,382 (GRCm39) missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55,443,977 (GRCm39) missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55,455,114 (GRCm39) missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55,479,155 (GRCm39) missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55,450,443 (GRCm39) nonsense probably null
R7213:Tubgcp5 UTSW 7 55,455,860 (GRCm39) missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55,473,315 (GRCm39) missense probably benign
R7600:Tubgcp5 UTSW 7 55,458,261 (GRCm39) missense probably benign
R7813:Tubgcp5 UTSW 7 55,450,444 (GRCm39) missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55,466,310 (GRCm39) missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55,443,996 (GRCm39) missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55,454,363 (GRCm39) missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55,454,363 (GRCm39) missense possibly damaging 0.67
R9087:Tubgcp5 UTSW 7 55,467,106 (GRCm39) missense probably damaging 1.00
R9211:Tubgcp5 UTSW 7 55,456,331 (GRCm39) missense probably benign 0.05
R9269:Tubgcp5 UTSW 7 55,445,693 (GRCm39) missense possibly damaging 0.94
R9329:Tubgcp5 UTSW 7 55,479,181 (GRCm39) critical splice donor site probably null
R9355:Tubgcp5 UTSW 7 55,467,177 (GRCm39) critical splice donor site probably null
R9498:Tubgcp5 UTSW 7 55,463,233 (GRCm39) missense possibly damaging 0.46
Z1088:Tubgcp5 UTSW 7 55,464,849 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCATTGTCTAGGGCTCAG -3'
(R):5'- GCTACATGCCTAGATACCGTC -3'

Sequencing Primer
(F):5'- CCAGCCTGGTCTATAAAGTGAGTTC -3'
(R):5'- ACATGCCTAGATACCGTCTTTCC -3'
Posted On 2022-10-06