Incidental Mutation 'R9687:Osbpl5'
ID 728914
Institutional Source Beutler Lab
Gene Symbol Osbpl5
Ensembl Gene ENSMUSG00000037606
Gene Name oxysterol binding protein-like 5
Synonyms Obph1, ORP5, 1110006M06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_024289 ; MGI: 1930265

Essential gene? Non essential (E-score: 0.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 143688762-143756985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143693861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 747 (Y747H)
Ref Sequence ENSEMBL: ENSMUSP00000020411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020411] [ENSMUST00000119499]
AlphaFold Q9ER64
Predicted Effect possibly damaging
Transcript: ENSMUST00000020411
AA Change: Y747H

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020411
Gene: ENSMUSG00000037606
AA Change: Y747H

DomainStartEndE-ValueType
PH 151 269 1.02e-14 SMART
Pfam:Oxysterol_BP 394 738 2.9e-91 PFAM
transmembrane domain 879 897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119499
AA Change: Y723H

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113362
Gene: ENSMUSG00000037606
AA Change: Y723H

DomainStartEndE-ValueType
coiled coil region 92 122 N/A INTRINSIC
PH 127 245 1.02e-14 SMART
Pfam:Oxysterol_BP 369 724 1e-93 PFAM
transmembrane domain 855 873 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors that play a key role in the maintenance of cholesterol balance in the body. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. This gene has been shown to be imprinted, with preferential expression from the maternal allele only in placenta. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,948,422 L446P probably damaging Het
Abcc9 T C 6: 142,633,163 T927A probably benign Het
Abraxas2 A G 7: 132,880,848 T258A probably benign Het
Akna A T 4: 63,374,437 C1078* probably null Het
Arhgap24 T A 5: 102,846,156 F34L probably benign Het
Cpa5 C T 6: 30,614,042 T61I probably benign Het
Crebrf A G 17: 26,763,627 *654W probably null Het
Dchs1 C A 7: 105,757,984 R2134L probably damaging Het
Dcps T C 9: 35,124,682 N303D probably damaging Het
Ddhd1 C T 14: 45,610,733 E527K probably damaging Het
Dnah14 T A 1: 181,598,413 M174K probably benign Het
Ehd1 A G 19: 6,298,300 D436G Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etv1 T C 12: 38,861,362 Y396H probably damaging Het
Fam189a2 A G 19: 23,979,665 I327T probably damaging Het
Fbxo11 A G 17: 88,009,066 I293T Het
Gcfc2 T A 6: 81,941,342 S338T probably damaging Het
Gm10272 T C 10: 77,706,930 V102A possibly damaging Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm17359 G A 3: 79,429,992 D36N possibly damaging Het
Gna14 G A 19: 16,604,986 R206Q Het
Gpm6a T C 8: 55,050,174 Y153H possibly damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
H2-M10.6 G A 17: 36,814,255 V313I probably benign Het
Igkv8-19 T C 6: 70,341,021 I74V probably benign Het
Kif24 A G 4: 41,428,546 L138P probably damaging Het
Kif26a A G 12: 112,177,191 E1293G probably damaging Het
Lrp1 A C 10: 127,566,693 L2203R probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Ncdn G A 4: 126,748,674 R397W probably damaging Het
Ncor1 A T 11: 62,369,367 I519N possibly damaging Het
Obsl1 A G 1: 75,503,026 V575A probably damaging Het
Olfr1031 G T 2: 85,991,876 V20L probably benign Het
Olfr1351 T A 10: 79,018,009 I229N probably damaging Het
Olfr1387 T C 11: 49,459,691 F4S probably benign Het
Pcdh18 T A 3: 49,756,587 D93V probably damaging Het
Ppef2 T A 5: 92,238,887 D397V probably benign Het
Ppfia4 G A 1: 134,317,956 T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 S178P probably damaging Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Pxk A G 14: 8,151,567 I461V possibly damaging Het
Rab18 T A 18: 6,784,622 N104K probably benign Het
Sars A G 3: 108,435,905 L90P probably benign Het
Scaf8 T A 17: 3,171,135 I299N unknown Het
Sh3bp2 C T 5: 34,559,633 P463S probably benign Het
Slc12a3 A G 8: 94,348,580 N734S possibly damaging Het
Slc12a7 G T 13: 73,790,677 R191L probably damaging Het
Slc7a12 A G 3: 14,480,900 Y35C possibly damaging Het
Susd4 A G 1: 182,895,197 probably null Het
Taar7f G A 10: 24,049,829 R107K probably benign Het
Tarm1 T C 7: 3,495,941 T237A probably benign Het
Tshr C A 12: 91,537,665 A459E probably damaging Het
Tubgcp5 G T 7: 55,825,579 probably null Het
Unc13b T C 4: 43,174,920 V1916A unknown Het
Unc45b A G 11: 82,919,736 D274G probably damaging Het
Vmn1r230 T A 17: 20,847,342 Y264* probably null Het
Vmn2r109 G T 17: 20,555,070 Q132K Het
Zbtb20 A G 16: 43,609,797 S151G possibly damaging Het
Zbtb22 A C 17: 33,917,876 T332P probably damaging Het
Zc3h6 A G 2: 129,017,361 D1104G probably damaging Het
Zfp748 A G 13: 67,542,352 V263A probably benign Het
Zhx3 A C 2: 160,781,758 V163G probably benign Het
Other mutations in Osbpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Osbpl5 APN 7 143715693 nonsense probably null
IGL01996:Osbpl5 APN 7 143707344 critical splice donor site probably null
IGL02135:Osbpl5 APN 7 143705125 missense probably damaging 1.00
IGL02331:Osbpl5 APN 7 143709795 missense probably benign 0.22
IGL02993:Osbpl5 APN 7 143699334 critical splice acceptor site probably null
R0240:Osbpl5 UTSW 7 143741669 splice site probably null
R0601:Osbpl5 UTSW 7 143709549 missense probably damaging 0.98
R0609:Osbpl5 UTSW 7 143694821 missense probably damaging 0.99
R0659:Osbpl5 UTSW 7 143705030 missense probably damaging 0.97
R1532:Osbpl5 UTSW 7 143695080 missense probably benign
R1579:Osbpl5 UTSW 7 143709202 missense possibly damaging 0.93
R1595:Osbpl5 UTSW 7 143703218 missense possibly damaging 0.88
R1666:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1668:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1713:Osbpl5 UTSW 7 143694373 missense probably damaging 1.00
R1868:Osbpl5 UTSW 7 143715773 missense probably damaging 1.00
R1901:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1902:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1903:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1911:Osbpl5 UTSW 7 143689925 missense probably benign 0.00
R1982:Osbpl5 UTSW 7 143741671 critical splice donor site probably null
R2014:Osbpl5 UTSW 7 143741692 missense probably damaging 0.98
R2076:Osbpl5 UTSW 7 143709144 missense probably damaging 1.00
R2192:Osbpl5 UTSW 7 143693859 nonsense probably null
R2256:Osbpl5 UTSW 7 143709094 missense probably damaging 1.00
R4271:Osbpl5 UTSW 7 143695602 nonsense probably null
R4418:Osbpl5 UTSW 7 143709815 nonsense probably null
R4450:Osbpl5 UTSW 7 143694906 missense probably benign 0.00
R4573:Osbpl5 UTSW 7 143694316 missense probably benign 0.00
R5325:Osbpl5 UTSW 7 143691928 missense probably damaging 0.99
R5439:Osbpl5 UTSW 7 143741696 missense possibly damaging 0.83
R5617:Osbpl5 UTSW 7 143692947 missense possibly damaging 0.89
R5775:Osbpl5 UTSW 7 143704529 missense probably benign 0.00
R5935:Osbpl5 UTSW 7 143756958 start gained probably benign
R6906:Osbpl5 UTSW 7 143694328 missense probably damaging 0.99
R7076:Osbpl5 UTSW 7 143709840 missense probably benign 0.12
R7117:Osbpl5 UTSW 7 143709783 missense probably benign 0.01
R7292:Osbpl5 UTSW 7 143701278 missense probably damaging 1.00
R7555:Osbpl5 UTSW 7 143694933 missense possibly damaging 0.65
R7594:Osbpl5 UTSW 7 143693797 missense probably benign 0.02
R8028:Osbpl5 UTSW 7 143715735 missense probably benign 0.00
R8061:Osbpl5 UTSW 7 143702724 missense probably benign 0.03
R8314:Osbpl5 UTSW 7 143695096 missense probably benign 0.05
R8482:Osbpl5 UTSW 7 143704994 missense probably benign 0.12
R9202:Osbpl5 UTSW 7 143700761 missense probably benign 0.45
R9430:Osbpl5 UTSW 7 143709789 missense probably benign 0.01
R9735:Osbpl5 UTSW 7 143694936 missense possibly damaging 0.76
R9749:Osbpl5 UTSW 7 143695571 missense probably benign 0.14
YA93:Osbpl5 UTSW 7 143693870 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACAGAGATGGGCACTGAG -3'
(R):5'- TACCTTAGGGACGAGGCATAAG -3'

Sequencing Primer
(F):5'- CACTGAGGGACAAAGGCC -3'
(R):5'- GTCAGATAGACCCCCTAATCCTTC -3'
Posted On 2022-10-06