Incidental Mutation 'R9687:Slc12a3'
ID 728916
Institutional Source Beutler Lab
Gene Symbol Slc12a3
Ensembl Gene ENSMUSG00000031766
Gene Name solute carrier family 12, member 3
Synonyms TSC, NCC
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 95055829-95092842 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95075208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 734 (N734S)
Ref Sequence ENSEMBL: ENSMUSP00000034218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034218] [ENSMUST00000212134]
AlphaFold P59158
Predicted Effect possibly damaging
Transcript: ENSMUST00000034218
AA Change: N734S

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034218
Gene: ENSMUSG00000031766
AA Change: N734S

DomainStartEndE-ValueType
Pfam:AA_permease_N 43 114 1.5e-30 PFAM
Pfam:AA_permease 139 645 3.6e-145 PFAM
Pfam:SLC12 653 801 1.4e-53 PFAM
Pfam:SLC12 787 1001 2e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212134
AA Change: N734S

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a renal thiazide-sensitive sodium-chloride cotransporter that is important for electrolyte homeostasis. This cotransporter mediates sodium and chloride reabsorption in the distal convoluted tubule. Mutations in this gene cause Gitelman syndrome, a disease similar to Bartter's syndrome, that is characterized by hypokalemic alkalosis combined with hypomagnesemia, low urinary calcium, and increased renin activity associated with normal blood pressure. This cotransporter is the target for thiazide diuretics that are used for treating high blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomagnesemia, hypocalciurua and abnormal renal distal convoluted tubule morphology, and show significantly reduced arterial blood pressure on a sodium-depleted diet. Mutant kidney cortical collecting ductsdisplay thiazide-sensitive NaCl absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Slc12a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Slc12a3 APN 8 95,083,724 (GRCm39) missense probably benign 0.00
IGL01947:Slc12a3 APN 8 95,092,447 (GRCm39) critical splice acceptor site probably null
IGL02151:Slc12a3 APN 8 95,075,220 (GRCm39) missense probably benign 0.26
IGL02440:Slc12a3 APN 8 95,058,310 (GRCm39) missense probably damaging 1.00
IGL03213:Slc12a3 APN 8 95,061,933 (GRCm39) missense possibly damaging 0.95
IGL03260:Slc12a3 APN 8 95,059,870 (GRCm39) missense probably damaging 1.00
IGL03306:Slc12a3 APN 8 95,078,386 (GRCm39) missense possibly damaging 0.72
IGL03329:Slc12a3 APN 8 95,092,519 (GRCm39) missense possibly damaging 0.67
avaricious UTSW 8 95,057,100 (GRCm39) missense probably benign 0.01
Pugilist UTSW 8 95,072,401 (GRCm39) critical splice acceptor site probably null
R0131:Slc12a3 UTSW 8 95,067,511 (GRCm39) splice site probably benign
R0189:Slc12a3 UTSW 8 95,082,986 (GRCm39) missense probably benign 0.30
R0330:Slc12a3 UTSW 8 95,072,974 (GRCm39) missense possibly damaging 0.75
R0569:Slc12a3 UTSW 8 95,057,153 (GRCm39) critical splice donor site probably null
R0715:Slc12a3 UTSW 8 95,056,061 (GRCm39) missense possibly damaging 0.75
R1248:Slc12a3 UTSW 8 95,059,905 (GRCm39) missense probably damaging 1.00
R1565:Slc12a3 UTSW 8 95,072,505 (GRCm39) missense possibly damaging 0.75
R2068:Slc12a3 UTSW 8 95,072,456 (GRCm39) missense probably damaging 1.00
R2108:Slc12a3 UTSW 8 95,067,158 (GRCm39) missense probably damaging 0.97
R2273:Slc12a3 UTSW 8 95,059,915 (GRCm39) missense possibly damaging 0.86
R2274:Slc12a3 UTSW 8 95,059,915 (GRCm39) missense possibly damaging 0.86
R2275:Slc12a3 UTSW 8 95,059,915 (GRCm39) missense possibly damaging 0.86
R2433:Slc12a3 UTSW 8 95,072,944 (GRCm39) missense probably benign 0.00
R3770:Slc12a3 UTSW 8 95,079,668 (GRCm39) missense probably benign
R4429:Slc12a3 UTSW 8 95,069,713 (GRCm39) missense probably damaging 1.00
R4431:Slc12a3 UTSW 8 95,069,713 (GRCm39) missense probably damaging 1.00
R4533:Slc12a3 UTSW 8 95,083,714 (GRCm39) missense probably null 0.02
R4627:Slc12a3 UTSW 8 95,056,012 (GRCm39) missense probably benign
R4856:Slc12a3 UTSW 8 95,078,438 (GRCm39) critical splice donor site probably null
R4886:Slc12a3 UTSW 8 95,078,438 (GRCm39) critical splice donor site probably null
R4908:Slc12a3 UTSW 8 95,075,216 (GRCm39) missense possibly damaging 0.76
R5054:Slc12a3 UTSW 8 95,072,979 (GRCm39) missense probably damaging 1.00
R5299:Slc12a3 UTSW 8 95,078,417 (GRCm39) missense probably damaging 1.00
R5451:Slc12a3 UTSW 8 95,083,655 (GRCm39) missense possibly damaging 0.61
R5590:Slc12a3 UTSW 8 95,072,416 (GRCm39) missense probably damaging 1.00
R5725:Slc12a3 UTSW 8 95,057,074 (GRCm39) missense probably benign 0.00
R6038:Slc12a3 UTSW 8 95,057,100 (GRCm39) missense probably benign 0.01
R6038:Slc12a3 UTSW 8 95,057,100 (GRCm39) missense probably benign 0.01
R6162:Slc12a3 UTSW 8 95,072,401 (GRCm39) critical splice acceptor site probably null
R6266:Slc12a3 UTSW 8 95,085,099 (GRCm39) missense possibly damaging 0.93
R6489:Slc12a3 UTSW 8 95,061,632 (GRCm39) missense possibly damaging 0.96
R6521:Slc12a3 UTSW 8 95,069,741 (GRCm39) missense possibly damaging 0.84
R6882:Slc12a3 UTSW 8 95,092,546 (GRCm39) missense possibly damaging 0.51
R7051:Slc12a3 UTSW 8 95,092,572 (GRCm39) missense probably damaging 1.00
R7510:Slc12a3 UTSW 8 95,092,477 (GRCm39) missense probably damaging 1.00
R7805:Slc12a3 UTSW 8 95,071,515 (GRCm39) missense probably damaging 1.00
R8152:Slc12a3 UTSW 8 95,057,012 (GRCm39) missense probably benign 0.00
R8412:Slc12a3 UTSW 8 95,060,695 (GRCm39) missense probably damaging 0.99
R8996:Slc12a3 UTSW 8 95,056,063 (GRCm39) missense probably benign
R9307:Slc12a3 UTSW 8 95,061,625 (GRCm39) missense probably benign 0.01
R9324:Slc12a3 UTSW 8 95,083,028 (GRCm39) critical splice donor site probably null
R9515:Slc12a3 UTSW 8 95,083,658 (GRCm39) missense possibly damaging 0.79
R9564:Slc12a3 UTSW 8 95,082,983 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTATAGACAGAACCCTGAGCC -3'
(R):5'- AGCTGAAAGTTCCTGCGAC -3'

Sequencing Primer
(F):5'- GAACCCTGAGCCCCTTGAAG -3'
(R):5'- ACCTCAGGGTCTATGAAGGTC -3'
Posted On 2022-10-06