Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Grip1'

728921

Institutional Source

Beutler Lab

Gene Symbol

Grip1

Ensembl Gene

ENSMUSG00000034813

Gene Name

glutamate receptor interacting protein 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119453830-120087261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 120038664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 778 (E778K)

Ref Sequence

ENSEMBL: ENSMUSP00000123234 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000081260] [ENSMUST00000105261] [ENSMUST00000105262] [ENSMUST00000130387] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954] [ENSMUST00000154238]

AlphaFold

Q925T6

PDB Structure

Solution Structure of the PDZ Domain from Mouse Glutamate Receptor Interacting Protein 1A-L (GRIP1) Homolog [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000041962
AA Change: E727K

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: E727K

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	354	367	N/A	INTRINSIC
low complexity region	388	405	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
PDZ	429	509	6.36e-17	SMART
PDZ	530	606	1.11e-16	SMART
PDZ	629	703	1.73e-18	SMART
PDZ	947	1019	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000077871
AA Change: E700K

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: E700K

Domain	Start	End	E-Value	Type
PDZ	36	110	4.86e-13	SMART
PDZ	134	212	6.4e-22	SMART
PDZ	235	310	1.97e-13	SMART
low complexity region	327	340	N/A	INTRINSIC
low complexity region	361	378	N/A	INTRINSIC
low complexity region	386	397	N/A	INTRINSIC
PDZ	402	482	6.36e-17	SMART
PDZ	503	579	1.11e-16	SMART
PDZ	602	676	1.73e-18	SMART
PDZ	920	992	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081260

SMART Domains

Protein: ENSMUSP00000080016
Gene: ENSMUSG00000034813

Domain	Start	End	E-Value	Type
low complexity region	49	60	N/A	INTRINSIC
PDZ	65	145	3e-19	SMART
PDZ	166	242	5.2e-19	SMART
PDZ	265	339	8.4e-21	SMART
PDZ	518	590	1.4e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105261

SMART Domains

Protein: ENSMUSP00000100896
Gene: ENSMUSG00000034813

Domain	Start	End	E-Value	Type
low complexity region	49	60	N/A	INTRINSIC
PDZ	65	145	6.36e-17	SMART
PDZ	166	242	1.11e-16	SMART
PDZ	265	339	1.73e-18	SMART
PDZ	518	590	2.79e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105262
AA Change: E726K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: E726K

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	946	1018	2.79e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130387
AA Change: E363K

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123288
Gene: ENSMUSG00000034813
AA Change: E363K

Domain	Start	End	E-Value	Type
low complexity region	49	60	N/A	INTRINSIC
PDZ	65	145	6.36e-17	SMART
PDZ	166	242	1.11e-16	SMART
PDZ	265	339	1.73e-18	SMART
PDZ	583	655	2.79e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138410
AA Change: E778K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: E778K

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	1013	1085	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144825
AA Change: E699K

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: E699K

Domain	Start	End	E-Value	Type
PDZ	35	109	4.86e-13	SMART
PDZ	133	211	6.4e-22	SMART
PDZ	234	309	1.97e-13	SMART
low complexity region	326	339	N/A	INTRINSIC
low complexity region	360	377	N/A	INTRINSIC
low complexity region	385	396	N/A	INTRINSIC
PDZ	401	481	6.36e-17	SMART
PDZ	502	578	1.11e-16	SMART
PDZ	601	675	1.73e-18	SMART
PDZ	919	991	2.79e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144959
AA Change: E778K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: E778K

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147356
AA Change: E779K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: E779K

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	394	422	N/A	INTRINSIC
low complexity region	440	457	N/A	INTRINSIC
low complexity region	465	476	N/A	INTRINSIC
PDZ	481	561	6.36e-17	SMART
PDZ	582	658	1.11e-16	SMART
PDZ	681	755	1.73e-18	SMART
PDZ	999	1071	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000147454
AA Change: E778K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: E778K

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148954
AA Change: E726K

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: E726K

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	961	1033	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154238
AA Change: E363K

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000122349
Gene: ENSMUSG00000034813
AA Change: E363K

Domain	Start	End	E-Value	Type
low complexity region	49	60	N/A	INTRINSIC
PDZ	65	145	6.36e-17	SMART
PDZ	166	242	1.11e-16	SMART
PDZ	265	339	1.73e-18	SMART
PDZ	598	670	2.79e-13	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Grip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01309:Grip1	APN	10	119931302	nonsense	probably null
IGL01374:Grip1	APN	10	120049368	missense	probably benign	0.03
IGL01592:Grip1	APN	10	119930003	missense	probably damaging	1.00
IGL02207:Grip1	APN	10	120075309	missense	probably damaging	1.00
IGL02222:Grip1	APN	10	119999809	missense	probably damaging	1.00
IGL02225:Grip1	APN	10	120049453	missense	probably damaging	1.00
IGL02447:Grip1	APN	10	120020071	missense	probably damaging	1.00
IGL02492:Grip1	APN	10	119930040	splice site	probably benign
IGL02522:Grip1	APN	10	119931249	missense	probably damaging	1.00
IGL02574:Grip1	APN	10	119942913	missense	probably damaging	1.00
IGL02718:Grip1	APN	10	120075515	makesense	probably null
IGL02751:Grip1	APN	10	119978577	missense	probably benign	0.08
IGL03221:Grip1	APN	10	119986394	missense	probably benign	0.00
IGL03377:Grip1	APN	10	120055032	missense	probably damaging	0.98
PIT4403001:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R0304:Grip1	UTSW	10	120075471	missense	probably benign	0.31
R0681:Grip1	UTSW	10	120010230	missense	probably damaging	1.00
R0760:Grip1	UTSW	10	120018078	missense	probably damaging	0.96
R1457:Grip1	UTSW	10	119986350	missense	possibly damaging	0.73
R1506:Grip1	UTSW	10	119978451	missense	probably damaging	1.00
R1541:Grip1	UTSW	10	120000543	missense	probably damaging	0.99
R1553:Grip1	UTSW	10	120054851	missense	probably damaging	1.00
R1709:Grip1	UTSW	10	119897715	missense	probably damaging	0.98
R2055:Grip1	UTSW	10	120049511	splice site	probably benign
R2059:Grip1	UTSW	10	120038698	missense	possibly damaging	0.80
R2261:Grip1	UTSW	10	119985584	missense	probably benign	0.00
R2475:Grip1	UTSW	10	119978496	missense	probably benign	0.01
R3777:Grip1	UTSW	10	119985630	critical splice donor site	probably null
R3849:Grip1	UTSW	10	119929958	missense	probably damaging	1.00
R3956:Grip1	UTSW	10	119930026	missense	probably damaging	1.00
R4643:Grip1	UTSW	10	120020101	missense	probably damaging	1.00
R4693:Grip1	UTSW	10	120000554	missense	probably benign	0.10
R4724:Grip1	UTSW	10	120038683	missense	probably benign	0.02
R4843:Grip1	UTSW	10	119930015	missense	probably damaging	1.00
R4884:Grip1	UTSW	10	120075306	missense	probably damaging	1.00
R4912:Grip1	UTSW	10	119931248	missense	probably damaging	1.00
R5185:Grip1	UTSW	10	119931259	missense	probably benign	0.37
R5291:Grip1	UTSW	10	120086969	missense	probably benign	0.04
R5293:Grip1	UTSW	10	119897735	missense	probably damaging	0.99
R5296:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R5302:Grip1	UTSW	10	120020077	missense	probably damaging	1.00
R5541:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R5792:Grip1	UTSW	10	119985480	missense	probably benign	0.07
R5861:Grip1	UTSW	10	119929970	missense	probably damaging	1.00
R5905:Grip1	UTSW	10	119985492	missense	probably benign	0.02
R5949:Grip1	UTSW	10	120050242	missense	probably benign	0.00
R6112:Grip1	UTSW	10	119993232	missense	probably benign	0.00
R6166:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R6167:Grip1	UTSW	10	119897797	critical splice donor site	probably null
R6193:Grip1	UTSW	10	120038314	missense	probably damaging	1.00
R6218:Grip1	UTSW	10	119986346	missense	possibly damaging	0.95
R6267:Grip1	UTSW	10	120075464	nonsense	probably null
R6296:Grip1	UTSW	10	120075464	nonsense	probably null
R6490:Grip1	UTSW	10	119986424	missense	possibly damaging	0.82
R6543:Grip1	UTSW	10	119985594	missense	probably benign	0.00
R6558:Grip1	UTSW	10	119454383	missense	probably benign	0.00
R6995:Grip1	UTSW	10	119986470	missense	probably damaging	0.99
R7122:Grip1	UTSW	10	120035374	missense	possibly damaging	0.48
R7157:Grip1	UTSW	10	119945156	missense	probably damaging	1.00
R7410:Grip1	UTSW	10	120020020	missense	probably benign	0.01
R7447:Grip1	UTSW	10	120086966	missense	probably benign	0.01
R7539:Grip1	UTSW	10	120054871	missense	probably benign	0.17
R7586:Grip1	UTSW	10	120077138	splice site	probably null
R7768:Grip1	UTSW	10	120038397	missense	probably damaging	0.98
R7831:Grip1	UTSW	10	120018106	missense	probably damaging	1.00
R7896:Grip1	UTSW	10	119978545	missense	possibly damaging	0.53
R8103:Grip1	UTSW	10	119978535	missense	probably benign	0.00
R8254:Grip1	UTSW	10	120054905	nonsense	probably null
R8688:Grip1	UTSW	10	119999904	missense	probably benign	0.12
R8823:Grip1	UTSW	10	119975951	missense
R8837:Grip1	UTSW	10	119930035	missense	probably damaging	1.00
R8885:Grip1	UTSW	10	119454287	start gained	probably benign
R8951:Grip1	UTSW	10	120038604	missense	possibly damaging	0.85
R9042:Grip1	UTSW	10	120000533	missense	probably benign	0.14
R9045:Grip1	UTSW	10	120035451	missense	probably damaging	0.97
R9237:Grip1	UTSW	10	120075405	missense	probably benign	0.07
R9254:Grip1	UTSW	10	119945056	missense	probably damaging	1.00
R9259:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9260:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9307:Grip1	UTSW	10	119985549	missense	probably benign	0.01
R9379:Grip1	UTSW	10	119945056	missense	probably damaging	1.00
R9546:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9547:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9548:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9549:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9583:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9584:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9610:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9611:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9612:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9684:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9690:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9691:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9742:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9744:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9752:Grip1	UTSW	10	120035351	missense	possibly damaging	0.46
R9758:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9762:Grip1	UTSW	10	119976001	missense	possibly damaging	0.92
R9764:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
RF011:Grip1	UTSW	10	119931315	missense	probably null	0.97
Z1176:Grip1	UTSW	10	119819483	unclassified	probably benign
Z1177:Grip1	UTSW	10	119986444	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGGGTTTCCAGCATGTTTCCTC -3'
(R):5'- GACACATTGAGTCAGCACGG -3'

Sequencing Primer
(F):5'- TCCCCTAAAAGAGTGTGCAGTGTC -3'
(R):5'- CACATTGAGTCAGCACGGGTTAC -3'

Posted On

2022-10-06