Incidental Mutation 'R9687:Or2y15'
ID 728924
Institutional Source Beutler Lab
Gene Symbol Or2y15
Ensembl Gene ENSMUSG00000063386
Gene Name olfactory receptor family 2 subfamily Y member 15
Synonyms MOR256-22, GA_x6K02T2QP88-5975166-5974231, Olfr1387
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 49350508-49351443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49350518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 4 (F4S)
Ref Sequence ENSEMBL: ENSMUSP00000151105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073824] [ENSMUST00000214541]
AlphaFold Q8VFA9
Predicted Effect probably benign
Transcript: ENSMUST00000073824
AA Change: F4S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073494
Gene: ENSMUSG00000063386
AA Change: F4S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1e-49 PFAM
Pfam:7tm_1 41 289 5.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214541
AA Change: F4S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Or2y15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Or2y15 APN 11 49,351,270 (GRCm39) missense probably benign 0.05
IGL01511:Or2y15 APN 11 49,351,043 (GRCm39) missense probably damaging 1.00
IGL02322:Or2y15 APN 11 49,350,784 (GRCm39) missense probably benign 0.12
R1028:Or2y15 UTSW 11 49,351,047 (GRCm39) missense probably benign 0.03
R2173:Or2y15 UTSW 11 49,350,967 (GRCm39) missense probably benign 0.00
R3894:Or2y15 UTSW 11 49,350,766 (GRCm39) missense possibly damaging 0.60
R5860:Or2y15 UTSW 11 49,350,563 (GRCm39) missense probably damaging 1.00
R6279:Or2y15 UTSW 11 49,351,039 (GRCm39) missense probably damaging 1.00
R6300:Or2y15 UTSW 11 49,351,039 (GRCm39) missense probably damaging 1.00
R6621:Or2y15 UTSW 11 49,350,598 (GRCm39) missense probably benign 0.09
R6836:Or2y15 UTSW 11 49,350,904 (GRCm39) missense possibly damaging 0.90
R6888:Or2y15 UTSW 11 49,351,087 (GRCm39) missense probably damaging 0.97
R9238:Or2y15 UTSW 11 49,350,529 (GRCm39) missense probably benign
Z1088:Or2y15 UTSW 11 49,351,283 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCCAGACAGTCAGATTGG -3'
(R):5'- AGTACATAGGTTTGTGCAGTCG -3'

Sequencing Primer
(F):5'- TCCAGACAGTCAGATTGGAGTTC -3'
(R):5'- TCGAAGGTCTAGTCTTGCAAGAAC -3'
Posted On 2022-10-06