Incidental Mutation 'R9687:Ncor1'
ID 728925
Institutional Source Beutler Lab
Gene Symbol Ncor1
Ensembl Gene ENSMUSG00000018501
Gene Name nuclear receptor co-repressor 1
Synonyms Rxrip13, 5730405M06Rik, A230020K14Rik, N-CoR
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 62207132-62348200 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62260193 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 519 (I519N)
Ref Sequence ENSEMBL: ENSMUSP00000125317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000127471] [ENSMUST00000151498] [ENSMUST00000155712]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000018645
AA Change: I929N

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: I929N

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
Pfam:GPS2_interact 150 239 1.4e-37 PFAM
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101066
AA Change: I929N

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: I929N

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101067
AA Change: I879N

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: I879N

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 716 734 N/A INTRINSIC
low complexity region 838 849 N/A INTRINSIC
low complexity region 937 945 N/A INTRINSIC
low complexity region 952 963 N/A INTRINSIC
low complexity region 986 999 N/A INTRINSIC
low complexity region 1448 1459 N/A INTRINSIC
coiled coil region 1645 1682 N/A INTRINSIC
low complexity region 1767 1781 N/A INTRINSIC
low complexity region 1902 1913 N/A INTRINSIC
low complexity region 1969 1988 N/A INTRINSIC
PDB:3N00|B 1997 2017 4e-7 PDB
low complexity region 2019 2034 N/A INTRINSIC
low complexity region 2089 2100 N/A INTRINSIC
PDB:2OVM|B 2199 2222 2e-8 PDB
low complexity region 2243 2256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127471
SMART Domains Protein: ENSMUSP00000121806
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 508 545 N/A INTRINSIC
low complexity region 594 618 N/A INTRINSIC
SANT 625 673 3.29e-14 SMART
low complexity region 711 732 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151498
AA Change: I519N

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501
AA Change: I519N

DomainStartEndE-ValueType
SANT 37 85 2.76e-7 SMART
coiled coil region 107 144 N/A INTRINSIC
low complexity region 193 217 N/A INTRINSIC
SANT 224 272 3.29e-14 SMART
low complexity region 316 337 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
internal_repeat_2 700 830 5.77e-7 PROSPERO
internal_repeat_2 855 961 5.77e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000155712
AA Change: I245N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: I245N

DomainStartEndE-ValueType
low complexity region 26 47 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 303 311 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 352 365 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
coiled coil region 982 1019 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
low complexity region 1239 1250 N/A INTRINSIC
low complexity region 1306 1325 N/A INTRINSIC
PDB:3N00|B 1334 1354 3e-7 PDB
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1427 1438 N/A INTRINSIC
PDB:2OVM|B 1537 1560 2e-8 PDB
low complexity region 1581 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161288
SMART Domains Protein: ENSMUSP00000124045
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
SANT 22 70 3.29e-14 SMART
low complexity region 114 135 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161699
SMART Domains Protein: ENSMUSP00000124120
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
coiled coil region 3 40 N/A INTRINSIC
low complexity region 90 114 N/A INTRINSIC
SANT 121 169 3.29e-14 SMART
low complexity region 207 225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162236
SMART Domains Protein: ENSMUSP00000124698
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
low complexity region 41 65 N/A INTRINSIC
SANT 72 120 3.29e-14 SMART
low complexity region 164 185 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Ncor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Ncor1 APN 11 62,283,354 (GRCm39) missense probably damaging 1.00
IGL01343:Ncor1 APN 11 62,216,312 (GRCm39) critical splice donor site probably null
IGL01392:Ncor1 APN 11 62,231,420 (GRCm39) missense probably damaging 0.99
IGL01402:Ncor1 APN 11 62,231,300 (GRCm39) missense probably damaging 1.00
IGL01714:Ncor1 APN 11 62,225,410 (GRCm39) missense possibly damaging 0.58
IGL01772:Ncor1 APN 11 62,240,173 (GRCm39) intron probably benign
IGL01889:Ncor1 APN 11 62,225,427 (GRCm39) missense possibly damaging 0.69
IGL02058:Ncor1 APN 11 62,235,463 (GRCm39) missense probably damaging 1.00
IGL02065:Ncor1 APN 11 62,310,435 (GRCm39) missense possibly damaging 0.95
IGL02073:Ncor1 APN 11 62,249,743 (GRCm39) missense probably damaging 0.99
IGL02176:Ncor1 APN 11 62,220,485 (GRCm39) unclassified probably benign
IGL02288:Ncor1 APN 11 62,240,229 (GRCm39) missense probably benign 0.01
IGL02348:Ncor1 APN 11 62,224,485 (GRCm39) splice site probably benign
IGL02608:Ncor1 APN 11 62,264,040 (GRCm39) missense probably benign 0.07
laggard UTSW 11 62,260,130 (GRCm39) missense probably damaging 1.00
Shortstep UTSW 11 62,225,367 (GRCm39) missense probably damaging 1.00
LCD18:Ncor1 UTSW 11 62,419,782 (GRCm38) critical splice acceptor site probably benign
PIT4382001:Ncor1 UTSW 11 62,235,489 (GRCm39) missense probably damaging 0.96
PIT4576001:Ncor1 UTSW 11 62,224,543 (GRCm39) missense probably damaging 0.99
R0026:Ncor1 UTSW 11 62,329,255 (GRCm39) missense probably damaging 1.00
R0038:Ncor1 UTSW 11 62,283,377 (GRCm39) missense probably damaging 0.99
R0038:Ncor1 UTSW 11 62,283,377 (GRCm39) missense probably damaging 0.99
R0103:Ncor1 UTSW 11 62,233,871 (GRCm39) missense possibly damaging 0.85
R0103:Ncor1 UTSW 11 62,233,871 (GRCm39) missense possibly damaging 0.85
R0144:Ncor1 UTSW 11 62,283,421 (GRCm39) missense probably damaging 1.00
R0427:Ncor1 UTSW 11 62,301,746 (GRCm39) missense probably damaging 1.00
R0501:Ncor1 UTSW 11 62,264,148 (GRCm39) missense possibly damaging 0.73
R0544:Ncor1 UTSW 11 62,224,603 (GRCm39) missense probably damaging 1.00
R0544:Ncor1 UTSW 11 62,224,602 (GRCm39) missense probably damaging 1.00
R0563:Ncor1 UTSW 11 62,234,056 (GRCm39) missense probably damaging 0.97
R1074:Ncor1 UTSW 11 62,283,377 (GRCm39) missense probably damaging 0.99
R1266:Ncor1 UTSW 11 62,224,866 (GRCm39) missense probably damaging 0.98
R1444:Ncor1 UTSW 11 62,294,632 (GRCm39) missense probably damaging 1.00
R1452:Ncor1 UTSW 11 62,225,457 (GRCm39) missense probably damaging 1.00
R1534:Ncor1 UTSW 11 62,269,330 (GRCm39) missense possibly damaging 0.92
R1710:Ncor1 UTSW 11 62,313,831 (GRCm39) missense probably damaging 1.00
R1762:Ncor1 UTSW 11 62,275,610 (GRCm39) missense possibly damaging 0.82
R1771:Ncor1 UTSW 11 62,217,938 (GRCm39) missense probably damaging 1.00
R1864:Ncor1 UTSW 11 62,272,245 (GRCm39) missense probably damaging 1.00
R1902:Ncor1 UTSW 11 62,228,984 (GRCm39) missense probably damaging 1.00
R1906:Ncor1 UTSW 11 62,240,211 (GRCm39) missense possibly damaging 0.81
R2009:Ncor1 UTSW 11 62,216,427 (GRCm39) missense probably benign 0.43
R3708:Ncor1 UTSW 11 62,235,513 (GRCm39) missense probably damaging 1.00
R3825:Ncor1 UTSW 11 62,264,183 (GRCm39) missense probably benign 0.00
R3923:Ncor1 UTSW 11 62,216,442 (GRCm39) missense probably damaging 1.00
R3966:Ncor1 UTSW 11 62,235,583 (GRCm39) missense probably damaging 1.00
R4049:Ncor1 UTSW 11 62,220,494 (GRCm39) splice site probably null
R4350:Ncor1 UTSW 11 62,301,644 (GRCm39) critical splice donor site probably null
R4351:Ncor1 UTSW 11 62,301,644 (GRCm39) critical splice donor site probably null
R4359:Ncor1 UTSW 11 62,249,736 (GRCm39) missense probably damaging 1.00
R4712:Ncor1 UTSW 11 62,235,660 (GRCm39) missense probably damaging 1.00
R4723:Ncor1 UTSW 11 62,269,438 (GRCm39) missense probably benign 0.26
R4863:Ncor1 UTSW 11 62,283,464 (GRCm39) missense possibly damaging 0.92
R4875:Ncor1 UTSW 11 62,324,437 (GRCm39) small deletion probably benign
R4956:Ncor1 UTSW 11 62,231,431 (GRCm39) missense probably damaging 1.00
R4993:Ncor1 UTSW 11 62,234,167 (GRCm39) missense probably damaging 1.00
R5079:Ncor1 UTSW 11 62,236,063 (GRCm39) missense possibly damaging 0.92
R5144:Ncor1 UTSW 11 62,240,290 (GRCm39) missense probably damaging 1.00
R5223:Ncor1 UTSW 11 62,229,826 (GRCm39) missense probably damaging 1.00
R5243:Ncor1 UTSW 11 62,229,788 (GRCm39) missense probably damaging 1.00
R5271:Ncor1 UTSW 11 62,231,371 (GRCm39) missense probably damaging 1.00
R5285:Ncor1 UTSW 11 62,283,475 (GRCm39) missense probably damaging 1.00
R5533:Ncor1 UTSW 11 62,233,837 (GRCm39) missense probably benign 0.00
R5580:Ncor1 UTSW 11 62,280,604 (GRCm39) nonsense probably null
R5593:Ncor1 UTSW 11 62,260,130 (GRCm39) missense probably damaging 1.00
R5609:Ncor1 UTSW 11 62,249,679 (GRCm39) splice site probably null
R5632:Ncor1 UTSW 11 62,229,060 (GRCm39) missense possibly damaging 0.85
R5830:Ncor1 UTSW 11 62,235,589 (GRCm39) missense possibly damaging 0.71
R5896:Ncor1 UTSW 11 62,274,016 (GRCm39) missense probably damaging 1.00
R5973:Ncor1 UTSW 11 62,240,136 (GRCm39) splice site probably null
R6013:Ncor1 UTSW 11 62,211,903 (GRCm39) missense probably benign
R6019:Ncor1 UTSW 11 62,263,987 (GRCm39) missense probably benign 0.00
R6032:Ncor1 UTSW 11 62,264,147 (GRCm39) missense possibly damaging 0.54
R6032:Ncor1 UTSW 11 62,264,147 (GRCm39) missense possibly damaging 0.54
R6075:Ncor1 UTSW 11 62,208,675 (GRCm39) missense probably damaging 1.00
R6091:Ncor1 UTSW 11 62,310,443 (GRCm39) missense probably damaging 0.98
R6248:Ncor1 UTSW 11 62,257,808 (GRCm39) missense probably damaging 1.00
R6281:Ncor1 UTSW 11 62,264,371 (GRCm39) missense possibly damaging 0.71
R6351:Ncor1 UTSW 11 62,264,124 (GRCm39) missense probably benign 0.30
R6469:Ncor1 UTSW 11 62,234,128 (GRCm39) missense probably damaging 1.00
R6502:Ncor1 UTSW 11 62,272,240 (GRCm39) nonsense probably null
R6614:Ncor1 UTSW 11 62,221,645 (GRCm39) missense probably benign 0.01
R6650:Ncor1 UTSW 11 62,225,367 (GRCm39) missense probably damaging 1.00
R6765:Ncor1 UTSW 11 62,264,272 (GRCm39) missense probably benign 0.01
R6852:Ncor1 UTSW 11 62,234,071 (GRCm39) missense probably damaging 0.97
R6909:Ncor1 UTSW 11 62,220,312 (GRCm39) missense probably damaging 1.00
R6965:Ncor1 UTSW 11 62,244,059 (GRCm39) critical splice donor site probably null
R7054:Ncor1 UTSW 11 62,275,619 (GRCm39) missense probably null
R7248:Ncor1 UTSW 11 62,275,598 (GRCm39) missense possibly damaging 0.89
R7352:Ncor1 UTSW 11 62,224,737 (GRCm39) missense probably damaging 0.99
R7396:Ncor1 UTSW 11 62,234,044 (GRCm39) missense probably damaging 0.99
R7434:Ncor1 UTSW 11 62,274,025 (GRCm39) missense probably damaging 0.99
R7552:Ncor1 UTSW 11 62,264,250 (GRCm39) missense possibly damaging 0.53
R7565:Ncor1 UTSW 11 62,292,091 (GRCm39) missense probably damaging 1.00
R7575:Ncor1 UTSW 11 62,274,082 (GRCm39) missense probably benign 0.21
R7622:Ncor1 UTSW 11 62,208,794 (GRCm39) missense probably benign 0.00
R7664:Ncor1 UTSW 11 62,289,154 (GRCm39) missense probably damaging 1.00
R7814:Ncor1 UTSW 11 62,224,752 (GRCm39) missense probably damaging 0.99
R7963:Ncor1 UTSW 11 62,225,359 (GRCm39) missense probably benign 0.28
R7990:Ncor1 UTSW 11 62,240,321 (GRCm39) critical splice acceptor site probably null
R8302:Ncor1 UTSW 11 62,224,681 (GRCm39) missense probably benign 0.00
R8334:Ncor1 UTSW 11 62,274,070 (GRCm39) missense probably damaging 0.99
R8512:Ncor1 UTSW 11 62,324,437 (GRCm39) small deletion probably benign
R8728:Ncor1 UTSW 11 62,221,685 (GRCm39) missense probably benign 0.04
R8777:Ncor1 UTSW 11 62,324,494 (GRCm39) missense probably damaging 1.00
R8777:Ncor1 UTSW 11 62,324,492 (GRCm39) missense probably benign 0.03
R8777-TAIL:Ncor1 UTSW 11 62,324,494 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Ncor1 UTSW 11 62,324,492 (GRCm39) missense probably benign 0.03
R8821:Ncor1 UTSW 11 62,260,234 (GRCm39) missense probably benign 0.07
R8831:Ncor1 UTSW 11 62,260,234 (GRCm39) missense probably benign 0.07
R8988:Ncor1 UTSW 11 62,233,871 (GRCm39) nonsense probably null
R9111:Ncor1 UTSW 11 62,280,585 (GRCm39) missense possibly damaging 0.95
R9147:Ncor1 UTSW 11 62,224,672 (GRCm39) missense probably damaging 1.00
R9391:Ncor1 UTSW 11 62,216,376 (GRCm39) nonsense probably null
R9467:Ncor1 UTSW 11 62,324,448 (GRCm39) small insertion probably benign
R9467:Ncor1 UTSW 11 62,324,437 (GRCm39) small insertion probably benign
R9510:Ncor1 UTSW 11 62,324,442 (GRCm39) small insertion probably benign
R9511:Ncor1 UTSW 11 62,324,449 (GRCm39) small insertion probably benign
R9560:Ncor1 UTSW 11 62,263,948 (GRCm39) missense possibly damaging 0.96
X0065:Ncor1 UTSW 11 62,249,817 (GRCm39) missense probably benign 0.23
X0065:Ncor1 UTSW 11 62,245,395 (GRCm39) critical splice donor site probably null
Z1176:Ncor1 UTSW 11 62,329,342 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTGCTTTTCACCACAGTATT -3'
(R):5'- ACTGTGTTTGTCGATTAAATGTAGA -3'

Sequencing Primer
(F):5'- ACAGTATTTTAAAAAGTCCAAGAGCC -3'
(R):5'- GTAAGGTCATGCTCATACTAGGCAC -3'
Posted On 2022-10-06