Incidental Mutation 'R9687:Unc45b'
ID 728926
Institutional Source Beutler Lab
Gene Symbol Unc45b
Ensembl Gene ENSMUSG00000018845
Gene Name unc-45 myosin chaperone B
Synonyms Cmya4, D230041A13Rik, UNC45
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 82910550-82943403 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82919736 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 274 (D274G)
Ref Sequence ENSEMBL: ENSMUSP00000018989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000108160] [ENSMUST00000164945]
AlphaFold Q8CGY6
Predicted Effect probably damaging
Transcript: ENSMUST00000018989
AA Change: D274G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845
AA Change: D274G

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 541 582 7e-7 BLAST
Blast:ARM 661 701 2e-14 BLAST
Blast:ARM 704 746 5e-11 BLAST
Blast:ARM 747 788 1e-20 BLAST
Blast:ARM 789 820 1e-11 BLAST
low complexity region 821 832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108160
AA Change: D274G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845
AA Change: D274G

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 271 489 2.2e-52 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164945
AA Change: D274G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845
AA Change: D274G

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,948,422 L446P probably damaging Het
Abcc9 T C 6: 142,633,163 T927A probably benign Het
Abraxas2 A G 7: 132,880,848 T258A probably benign Het
Akna A T 4: 63,374,437 C1078* probably null Het
Arhgap24 T A 5: 102,846,156 F34L probably benign Het
Cpa5 C T 6: 30,614,042 T61I probably benign Het
Crebrf A G 17: 26,763,627 *654W probably null Het
Dchs1 C A 7: 105,757,984 R2134L probably damaging Het
Dcps T C 9: 35,124,682 N303D probably damaging Het
Ddhd1 C T 14: 45,610,733 E527K probably damaging Het
Dnah14 T A 1: 181,598,413 M174K probably benign Het
Ehd1 A G 19: 6,298,300 D436G Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etv1 T C 12: 38,861,362 Y396H probably damaging Het
Fam189a2 A G 19: 23,979,665 I327T probably damaging Het
Fbxo11 A G 17: 88,009,066 I293T Het
Gcfc2 T A 6: 81,941,342 S338T probably damaging Het
Gm10272 T C 10: 77,706,930 V102A possibly damaging Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm17359 G A 3: 79,429,992 D36N possibly damaging Het
Gna14 G A 19: 16,604,986 R206Q Het
Gpm6a T C 8: 55,050,174 Y153H possibly damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
H2-M10.6 G A 17: 36,814,255 V313I probably benign Het
Igkv8-19 T C 6: 70,341,021 I74V probably benign Het
Kif24 A G 4: 41,428,546 L138P probably damaging Het
Kif26a A G 12: 112,177,191 E1293G probably damaging Het
Lrp1 A C 10: 127,566,693 L2203R probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Ncdn G A 4: 126,748,674 R397W probably damaging Het
Ncor1 A T 11: 62,369,367 I519N possibly damaging Het
Obsl1 A G 1: 75,503,026 V575A probably damaging Het
Olfr1031 G T 2: 85,991,876 V20L probably benign Het
Olfr1351 T A 10: 79,018,009 I229N probably damaging Het
Olfr1387 T C 11: 49,459,691 F4S probably benign Het
Osbpl5 A G 7: 143,693,861 Y747H possibly damaging Het
Pcdh18 T A 3: 49,756,587 D93V probably damaging Het
Ppef2 T A 5: 92,238,887 D397V probably benign Het
Ppfia4 G A 1: 134,317,956 T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 S178P probably damaging Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Pxk A G 14: 8,151,567 I461V possibly damaging Het
Rab18 T A 18: 6,784,622 N104K probably benign Het
Sars A G 3: 108,435,905 L90P probably benign Het
Scaf8 T A 17: 3,171,135 I299N unknown Het
Sh3bp2 C T 5: 34,559,633 P463S probably benign Het
Slc12a3 A G 8: 94,348,580 N734S possibly damaging Het
Slc12a7 G T 13: 73,790,677 R191L probably damaging Het
Slc7a12 A G 3: 14,480,900 Y35C possibly damaging Het
Susd4 A G 1: 182,895,197 probably null Het
Taar7f G A 10: 24,049,829 R107K probably benign Het
Tarm1 T C 7: 3,495,941 T237A probably benign Het
Tshr C A 12: 91,537,665 A459E probably damaging Het
Tubgcp5 G T 7: 55,825,579 probably null Het
Unc13b T C 4: 43,174,920 V1916A unknown Het
Vmn1r230 T A 17: 20,847,342 Y264* probably null Het
Vmn2r109 G T 17: 20,555,070 Q132K Het
Zbtb20 A G 16: 43,609,797 S151G possibly damaging Het
Zbtb22 A C 17: 33,917,876 T332P probably damaging Het
Zc3h6 A G 2: 129,017,361 D1104G probably damaging Het
Zfp748 A G 13: 67,542,352 V263A probably benign Het
Zhx3 A C 2: 160,781,758 V163G probably benign Het
Other mutations in Unc45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Unc45b APN 11 82912393 critical splice acceptor site probably null
IGL01983:Unc45b APN 11 82936861 missense probably benign
IGL02083:Unc45b APN 11 82922919 missense probably damaging 0.96
IGL02159:Unc45b APN 11 82940181 splice site probably benign
IGL02160:Unc45b APN 11 82940181 splice site probably benign
IGL02165:Unc45b APN 11 82940181 splice site probably benign
IGL02166:Unc45b APN 11 82940181 splice site probably benign
IGL02986:Unc45b APN 11 82917179 missense probably damaging 0.98
fife UTSW 11 82936852 missense probably benign 0.00
R0195:Unc45b UTSW 11 82937828 missense probably damaging 1.00
R0197:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0218:Unc45b UTSW 11 82911860 splice site probably benign
R0436:Unc45b UTSW 11 82929567 splice site probably benign
R0569:Unc45b UTSW 11 82936812 splice site probably benign
R0701:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0883:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1378:Unc45b UTSW 11 82936852 missense probably benign 0.00
R1446:Unc45b UTSW 11 82928670 missense probably damaging 1.00
R1532:Unc45b UTSW 11 82936874 missense probably benign 0.12
R1559:Unc45b UTSW 11 82917846 missense possibly damaging 0.66
R1582:Unc45b UTSW 11 82925945 missense probably benign 0.30
R1628:Unc45b UTSW 11 82929380 splice site probably null
R1666:Unc45b UTSW 11 82917739 missense probably benign 0.31
R1677:Unc45b UTSW 11 82911705 splice site probably null
R1759:Unc45b UTSW 11 82929499 missense probably benign 0.33
R1909:Unc45b UTSW 11 82926087 missense probably damaging 1.00
R2067:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2111:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2145:Unc45b UTSW 11 82917754 missense probably benign 0.30
R2258:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2259:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2497:Unc45b UTSW 11 82936443 missense probably damaging 1.00
R2507:Unc45b UTSW 11 82940137 splice site probably null
R4352:Unc45b UTSW 11 82913209 missense probably damaging 0.99
R4569:Unc45b UTSW 11 82936489 critical splice donor site probably null
R4624:Unc45b UTSW 11 82926009 missense probably benign 0.30
R5236:Unc45b UTSW 11 82915062 missense possibly damaging 0.53
R5512:Unc45b UTSW 11 82915072 missense possibly damaging 0.47
R5688:Unc45b UTSW 11 82922817 missense possibly damaging 0.88
R6029:Unc45b UTSW 11 82913327 missense probably damaging 1.00
R6616:Unc45b UTSW 11 82911819 missense probably damaging 1.00
R6857:Unc45b UTSW 11 82913212 missense probably benign 0.00
R6876:Unc45b UTSW 11 82922912 missense probably benign 0.00
R7197:Unc45b UTSW 11 82940187 critical splice acceptor site probably null
R7368:Unc45b UTSW 11 82942495 missense probably benign 0.01
R7531:Unc45b UTSW 11 82929012 missense probably damaging 1.00
R7743:Unc45b UTSW 11 82922900 missense probably damaging 1.00
R8198:Unc45b UTSW 11 82925988 frame shift probably null
R8214:Unc45b UTSW 11 82933888 missense possibly damaging 0.50
R8235:Unc45b UTSW 11 82919855 missense probably benign 0.01
R8916:Unc45b UTSW 11 82913212 missense probably benign 0.00
R9004:Unc45b UTSW 11 82928689 missense probably damaging 1.00
R9521:Unc45b UTSW 11 82917760 missense probably benign 0.09
R9757:Unc45b UTSW 11 82919732 missense probably damaging 0.99
R9784:Unc45b UTSW 11 82926160 missense probably damaging 1.00
T0970:Unc45b UTSW 11 82922888 missense probably benign 0.00
Z1176:Unc45b UTSW 11 82928654 critical splice acceptor site probably null
Z1176:Unc45b UTSW 11 82942715 missense probably damaging 1.00
Z1177:Unc45b UTSW 11 82942553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTAGAGCCCCTCCAAATAGC -3'
(R):5'- GTATGACTGAACCCCAAGCTC -3'

Sequencing Primer
(F):5'- ATCAACTGAAAAGCACTTCTGAGG -3'
(R):5'- TGAACCCCAAGCTCCTTCATC -3'
Posted On 2022-10-06