Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Unc45b'

728926

Institutional Source

Beutler Lab

Gene Symbol

Unc45b

Ensembl Gene

ENSMUSG00000018845

Gene Name

unc-45 myosin chaperone B

Synonyms

Cmya4, D230041A13Rik, UNC45

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

82910550-82943403 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82919736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 274 (D274G)

Ref Sequence

ENSEMBL: ENSMUSP00000018989 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000108160] [ENSMUST00000164945]

AlphaFold

Q8CGY6

Predicted Effect

probably damaging
Transcript: ENSMUST00000018989
AA Change: D274G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845
AA Change: D274G

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	298	489	1.7e-41	PFAM
Blast:ARM	541	582	7e-7	BLAST
Blast:ARM	661	701	2e-14	BLAST
Blast:ARM	704	746	5e-11	BLAST
Blast:ARM	747	788	1e-20	BLAST
Blast:ARM	789	820	1e-11	BLAST
low complexity region	821	832	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108160
AA Change: D274G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845
AA Change: D274G

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	271	489	2.2e-52	PFAM
Blast:ARM	663	703	2e-14	BLAST
Blast:ARM	706	748	5e-11	BLAST
Blast:ARM	749	790	1e-20	BLAST
Blast:ARM	791	822	1e-11	BLAST
low complexity region	823	834	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164945
AA Change: D274G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845
AA Change: D274G

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	298	489	1.7e-41	PFAM
Blast:ARM	663	703	2e-14	BLAST
Blast:ARM	706	748	5e-11	BLAST
Blast:ARM	749	790	1e-20	BLAST
Blast:ARM	791	822	1e-11	BLAST
low complexity region	823	834	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Unc45b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01320:Unc45b	APN	11	82912393	critical splice acceptor site	probably null
IGL01983:Unc45b	APN	11	82936861	missense	probably benign
IGL02083:Unc45b	APN	11	82922919	missense	probably damaging	0.96
IGL02159:Unc45b	APN	11	82940181	splice site	probably benign
IGL02160:Unc45b	APN	11	82940181	splice site	probably benign
IGL02165:Unc45b	APN	11	82940181	splice site	probably benign
IGL02166:Unc45b	APN	11	82940181	splice site	probably benign
IGL02986:Unc45b	APN	11	82917179	missense	probably damaging	0.98
fife	UTSW	11	82936852	missense	probably benign	0.00
R0195:Unc45b	UTSW	11	82937828	missense	probably damaging	1.00
R0197:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R0218:Unc45b	UTSW	11	82911860	splice site	probably benign
R0436:Unc45b	UTSW	11	82929567	splice site	probably benign
R0569:Unc45b	UTSW	11	82936812	splice site	probably benign
R0701:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R0883:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R1146:Unc45b	UTSW	11	82922907	missense	probably damaging	0.99
R1146:Unc45b	UTSW	11	82922907	missense	probably damaging	0.99
R1378:Unc45b	UTSW	11	82936852	missense	probably benign	0.00
R1446:Unc45b	UTSW	11	82928670	missense	probably damaging	1.00
R1532:Unc45b	UTSW	11	82936874	missense	probably benign	0.12
R1559:Unc45b	UTSW	11	82917846	missense	possibly damaging	0.66
R1582:Unc45b	UTSW	11	82925945	missense	probably benign	0.30
R1628:Unc45b	UTSW	11	82929380	splice site	probably null
R1666:Unc45b	UTSW	11	82917739	missense	probably benign	0.31
R1677:Unc45b	UTSW	11	82911705	splice site	probably null
R1759:Unc45b	UTSW	11	82929499	missense	probably benign	0.33
R1909:Unc45b	UTSW	11	82926087	missense	probably damaging	1.00
R2067:Unc45b	UTSW	11	82911689	missense	probably benign	0.01
R2111:Unc45b	UTSW	11	82911689	missense	probably benign	0.01
R2145:Unc45b	UTSW	11	82917754	missense	probably benign	0.30
R2258:Unc45b	UTSW	11	82917799	missense	probably benign	0.01
R2259:Unc45b	UTSW	11	82917799	missense	probably benign	0.01
R2497:Unc45b	UTSW	11	82936443	missense	probably damaging	1.00
R2507:Unc45b	UTSW	11	82940137	splice site	probably null
R4352:Unc45b	UTSW	11	82913209	missense	probably damaging	0.99
R4569:Unc45b	UTSW	11	82936489	critical splice donor site	probably null
R4624:Unc45b	UTSW	11	82926009	missense	probably benign	0.30
R5236:Unc45b	UTSW	11	82915062	missense	possibly damaging	0.53
R5512:Unc45b	UTSW	11	82915072	missense	possibly damaging	0.47
R5688:Unc45b	UTSW	11	82922817	missense	possibly damaging	0.88
R6029:Unc45b	UTSW	11	82913327	missense	probably damaging	1.00
R6616:Unc45b	UTSW	11	82911819	missense	probably damaging	1.00
R6857:Unc45b	UTSW	11	82913212	missense	probably benign	0.00
R6876:Unc45b	UTSW	11	82922912	missense	probably benign	0.00
R7197:Unc45b	UTSW	11	82940187	critical splice acceptor site	probably null
R7368:Unc45b	UTSW	11	82942495	missense	probably benign	0.01
R7531:Unc45b	UTSW	11	82929012	missense	probably damaging	1.00
R7743:Unc45b	UTSW	11	82922900	missense	probably damaging	1.00
R8198:Unc45b	UTSW	11	82925988	frame shift	probably null
R8214:Unc45b	UTSW	11	82933888	missense	possibly damaging	0.50
R8235:Unc45b	UTSW	11	82919855	missense	probably benign	0.01
R8916:Unc45b	UTSW	11	82913212	missense	probably benign	0.00
R9004:Unc45b	UTSW	11	82928689	missense	probably damaging	1.00
R9521:Unc45b	UTSW	11	82917760	missense	probably benign	0.09
R9757:Unc45b	UTSW	11	82919732	missense	probably damaging	0.99
R9784:Unc45b	UTSW	11	82926160	missense	probably damaging	1.00
T0970:Unc45b	UTSW	11	82922888	missense	probably benign	0.00
Z1176:Unc45b	UTSW	11	82928654	critical splice acceptor site	probably null
Z1176:Unc45b	UTSW	11	82942715	missense	probably damaging	1.00
Z1177:Unc45b	UTSW	11	82942553	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCTAGAGCCCCTCCAAATAGC -3'
(R):5'- GTATGACTGAACCCCAAGCTC -3'

Sequencing Primer
(F):5'- ATCAACTGAAAAGCACTTCTGAGG -3'
(R):5'- TGAACCCCAAGCTCCTTCATC -3'

Posted On

2022-10-06