Incidental Mutation 'R9687:Etv1'
ID 728927
Institutional Source Beutler Lab
Gene Symbol Etv1
Ensembl Gene ENSMUSG00000004151
Gene Name ets variant 1
Synonyms Etsrp81, ER81
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.490) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 38779380-38870484 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38861362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 396 (Y396H)
Ref Sequence ENSEMBL: ENSMUSP00000093442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000161980] [ENSMUST00000162563]
AlphaFold P41164
Predicted Effect probably damaging
Transcript: ENSMUST00000095767
AA Change: Y396H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151
AA Change: Y396H

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5e-153 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159334
AA Change: Y356H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151
AA Change: Y356H

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 16 293 1.1e-112 PFAM
ETS 294 379 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160244
AA Change: Y373H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151
AA Change: Y373H

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 310 2.5e-133 PFAM
ETS 311 396 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160701
AA Change: Y293H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151
AA Change: Y293H

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 14 82 1.4e-30 PFAM
Pfam:ETS_PEA3_N 80 230 1.6e-68 PFAM
ETS 231 316 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160856
AA Change: Y378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151
AA Change: Y378H

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 315 3.8e-130 PFAM
ETS 316 401 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161980
AA Change: Y338H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151
AA Change: Y338H

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 10 275 3.2e-104 PFAM
ETS 276 361 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162563
AA Change: Y396H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151
AA Change: Y396H

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5.6e-150 PFAM
ETS 334 419 1.72e-57 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,948,422 L446P probably damaging Het
Abcc9 T C 6: 142,633,163 T927A probably benign Het
Abraxas2 A G 7: 132,880,848 T258A probably benign Het
Akna A T 4: 63,374,437 C1078* probably null Het
Arhgap24 T A 5: 102,846,156 F34L probably benign Het
Cpa5 C T 6: 30,614,042 T61I probably benign Het
Crebrf A G 17: 26,763,627 *654W probably null Het
Dchs1 C A 7: 105,757,984 R2134L probably damaging Het
Dcps T C 9: 35,124,682 N303D probably damaging Het
Ddhd1 C T 14: 45,610,733 E527K probably damaging Het
Dnah14 T A 1: 181,598,413 M174K probably benign Het
Ehd1 A G 19: 6,298,300 D436G Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fam189a2 A G 19: 23,979,665 I327T probably damaging Het
Fbxo11 A G 17: 88,009,066 I293T Het
Gcfc2 T A 6: 81,941,342 S338T probably damaging Het
Gm10272 T C 10: 77,706,930 V102A possibly damaging Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm17359 G A 3: 79,429,992 D36N possibly damaging Het
Gna14 G A 19: 16,604,986 R206Q Het
Gpm6a T C 8: 55,050,174 Y153H possibly damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
H2-M10.6 G A 17: 36,814,255 V313I probably benign Het
Igkv8-19 T C 6: 70,341,021 I74V probably benign Het
Kif24 A G 4: 41,428,546 L138P probably damaging Het
Kif26a A G 12: 112,177,191 E1293G probably damaging Het
Lrp1 A C 10: 127,566,693 L2203R probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Ncdn G A 4: 126,748,674 R397W probably damaging Het
Ncor1 A T 11: 62,369,367 I519N possibly damaging Het
Obsl1 A G 1: 75,503,026 V575A probably damaging Het
Olfr1031 G T 2: 85,991,876 V20L probably benign Het
Olfr1351 T A 10: 79,018,009 I229N probably damaging Het
Olfr1387 T C 11: 49,459,691 F4S probably benign Het
Osbpl5 A G 7: 143,693,861 Y747H possibly damaging Het
Pcdh18 T A 3: 49,756,587 D93V probably damaging Het
Ppef2 T A 5: 92,238,887 D397V probably benign Het
Ppfia4 G A 1: 134,317,956 T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 S178P probably damaging Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Pxk A G 14: 8,151,567 I461V possibly damaging Het
Rab18 T A 18: 6,784,622 N104K probably benign Het
Sars A G 3: 108,435,905 L90P probably benign Het
Scaf8 T A 17: 3,171,135 I299N unknown Het
Sh3bp2 C T 5: 34,559,633 P463S probably benign Het
Slc12a3 A G 8: 94,348,580 N734S possibly damaging Het
Slc12a7 G T 13: 73,790,677 R191L probably damaging Het
Slc7a12 A G 3: 14,480,900 Y35C possibly damaging Het
Susd4 A G 1: 182,895,197 probably null Het
Taar7f G A 10: 24,049,829 R107K probably benign Het
Tarm1 T C 7: 3,495,941 T237A probably benign Het
Tshr C A 12: 91,537,665 A459E probably damaging Het
Tubgcp5 G T 7: 55,825,579 probably null Het
Unc13b T C 4: 43,174,920 V1916A unknown Het
Unc45b A G 11: 82,919,736 D274G probably damaging Het
Vmn1r230 T A 17: 20,847,342 Y264* probably null Het
Vmn2r109 G T 17: 20,555,070 Q132K Het
Zbtb20 A G 16: 43,609,797 S151G possibly damaging Het
Zbtb22 A C 17: 33,917,876 T332P probably damaging Het
Zc3h6 A G 2: 129,017,361 D1104G probably damaging Het
Zfp748 A G 13: 67,542,352 V263A probably benign Het
Zhx3 A C 2: 160,781,758 V163G probably benign Het
Other mutations in Etv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Etv1 APN 12 38781792 splice site probably benign
IGL01376:Etv1 APN 12 38857040 missense probably damaging 1.00
IGL01387:Etv1 APN 12 38861327 missense probably damaging 0.99
IGL01936:Etv1 APN 12 38835061 splice site probably benign
IGL02388:Etv1 APN 12 38781799 missense possibly damaging 0.62
IGL02933:Etv1 APN 12 38781833 missense probably benign 0.22
R0844:Etv1 UTSW 12 38861354 missense probably damaging 1.00
R0993:Etv1 UTSW 12 38827864 missense probably damaging 1.00
R1187:Etv1 UTSW 12 38865564 missense probably damaging 1.00
R1710:Etv1 UTSW 12 38852262 missense probably benign 0.18
R2094:Etv1 UTSW 12 38835116 missense probably null 1.00
R2879:Etv1 UTSW 12 38783810 splice site probably null
R3607:Etv1 UTSW 12 38831086 missense probably damaging 1.00
R4353:Etv1 UTSW 12 38857106 missense probably damaging 1.00
R4646:Etv1 UTSW 12 38865686 missense possibly damaging 0.94
R4678:Etv1 UTSW 12 38835220 missense probably damaging 1.00
R4768:Etv1 UTSW 12 38827793 missense probably damaging 1.00
R4812:Etv1 UTSW 12 38861288 missense probably damaging 1.00
R4877:Etv1 UTSW 12 38831293 splice site probably null
R5024:Etv1 UTSW 12 38854234 splice site probably null
R5253:Etv1 UTSW 12 38852249 missense possibly damaging 0.50
R5936:Etv1 UTSW 12 38835210 missense probably damaging 1.00
R6085:Etv1 UTSW 12 38854195 missense probably damaging 1.00
R6167:Etv1 UTSW 12 38865641 missense possibly damaging 0.88
R6709:Etv1 UTSW 12 38783797 missense possibly damaging 0.93
R7046:Etv1 UTSW 12 38784370 splice site probably null
R7243:Etv1 UTSW 12 38857046 missense probably benign 0.36
R7616:Etv1 UTSW 12 38865606 missense probably damaging 1.00
R8230:Etv1 UTSW 12 38780936 start codon destroyed probably null 1.00
R9021:Etv1 UTSW 12 38780972 missense probably benign 0.01
R9182:Etv1 UTSW 12 38780717 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATTTGAAAGGTGCGTTTAGAAGTC -3'
(R):5'- ATAGAGTCCTGATATCCTAAGCAGG -3'

Sequencing Primer
(F):5'- ATTTATGAACTCTCTCTCTCTCTCTC -3'
(R):5'- CTAAGCAGGAGCCAAGTTGTGTC -3'
Posted On 2022-10-06