Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Kif26a'

728929

Institutional Source

Beutler Lab

Gene Symbol

Kif26a

Ensembl Gene

ENSMUSG00000021294

Gene Name

kinesin family member 26A

Synonyms

N-11 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112146208-112181747 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112177191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1293 (E1293G)

Ref Sequence

ENSEMBL: ENSMUSP00000119482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128402]

AlphaFold

Q52KG5

Predicted Effect

probably damaging
Transcript: ENSMUST00000128402
AA Change: E1293G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119482
Gene: ENSMUSG00000021294
AA Change: E1293G

Domain	Start	End	E-Value	Type
low complexity region	238	248	N/A	INTRINSIC
low complexity region	279	297	N/A	INTRINSIC
KISc	362	726	9.57e-35	SMART
low complexity region	727	739	N/A	INTRINSIC
low complexity region	740	754	N/A	INTRINSIC
low complexity region	932	957	N/A	INTRINSIC
low complexity region	1005	1012	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1084	1095	N/A	INTRINSIC
low complexity region	1328	1360	N/A	INTRINSIC
low complexity region	1458	1471	N/A	INTRINSIC
low complexity region	1477	1493	N/A	INTRINSIC
low complexity region	1519	1538	N/A	INTRINSIC
low complexity region	1574	1587	N/A	INTRINSIC
low complexity region	1664	1675	N/A	INTRINSIC
low complexity region	1699	1713	N/A	INTRINSIC
coiled coil region	1780	1812	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death associated with megacolon and hyperganglionosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Kif26a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Kif26a	APN	12	112157632	missense	probably damaging	0.97
IGL01734:Kif26a	APN	12	112176828	missense	probably benign	0.23
IGL01916:Kif26a	APN	12	112176894	missense	possibly damaging	0.49
IGL02080:Kif26a	APN	12	112157566	missense	probably damaging	1.00
IGL02138:Kif26a	APN	12	112174850	missense	probably damaging	1.00
IGL02145:Kif26a	APN	12	112176975	missense	probably benign	0.00
IGL02285:Kif26a	APN	12	112157507	missense	probably damaging	1.00
IGL02393:Kif26a	APN	12	112172664	missense	probably damaging	1.00
IGL02445:Kif26a	APN	12	112173743	missense	probably damaging	1.00
IGL02865:Kif26a	APN	12	112177615	nonsense	probably null
IGL03057:Kif26a	APN	12	112175774	nonsense	probably null
IGL03204:Kif26a	APN	12	112174779	missense	probably damaging	1.00
R0013:Kif26a	UTSW	12	112177880	missense	probably benign	0.03
R0034:Kif26a	UTSW	12	112168963	splice site	probably benign
R0089:Kif26a	UTSW	12	112177403	missense	probably damaging	0.98
R0111:Kif26a	UTSW	12	112163337	splice site	probably benign
R0220:Kif26a	UTSW	12	112157390	missense	probably damaging	0.98
R0346:Kif26a	UTSW	12	112179348	missense	probably null	0.09
R0383:Kif26a	UTSW	12	112178076	missense	possibly damaging	0.94
R0478:Kif26a	UTSW	12	112175789	missense	probably damaging	1.00
R0494:Kif26a	UTSW	12	112179471	splice site	probably null
R1163:Kif26a	UTSW	12	112179945	missense	probably benign	0.08
R1450:Kif26a	UTSW	12	112173852	missense	probably damaging	1.00
R1512:Kif26a	UTSW	12	112146955	missense	possibly damaging	0.47
R1616:Kif26a	UTSW	12	112157246	critical splice acceptor site	probably null
R1723:Kif26a	UTSW	12	112173858	missense	possibly damaging	0.67
R1728:Kif26a	UTSW	12	112176785	missense	possibly damaging	0.95
R1729:Kif26a	UTSW	12	112176785	missense	possibly damaging	0.95
R1903:Kif26a	UTSW	12	112175540	missense	probably damaging	1.00
R2283:Kif26a	UTSW	12	112177353	missense	possibly damaging	0.66
R3862:Kif26a	UTSW	12	112179889	missense	probably benign	0.30
R3906:Kif26a	UTSW	12	112176890	missense	probably benign
R4050:Kif26a	UTSW	12	112179916	missense	probably benign	0.08
R4270:Kif26a	UTSW	12	112173414	missense	probably damaging	1.00
R4271:Kif26a	UTSW	12	112173414	missense	probably damaging	1.00
R4731:Kif26a	UTSW	12	112175573	missense	probably benign
R4732:Kif26a	UTSW	12	112175573	missense	probably benign
R4733:Kif26a	UTSW	12	112175573	missense	probably benign
R4908:Kif26a	UTSW	12	112157342	missense	probably damaging	1.00
R4946:Kif26a	UTSW	12	112177794	missense	probably damaging	0.99
R5566:Kif26a	UTSW	12	112157354	missense	probably damaging	1.00
R6280:Kif26a	UTSW	12	112174869	missense	probably damaging	0.99
R6422:Kif26a	UTSW	12	112168875	missense	possibly damaging	0.95
R6513:Kif26a	UTSW	12	112175492	missense	probably damaging	0.97
R6860:Kif26a	UTSW	12	112146829	missense	probably damaging	1.00
R6879:Kif26a	UTSW	12	112177653	missense	probably benign
R7127:Kif26a	UTSW	12	112178145	missense	probably damaging	1.00
R7366:Kif26a	UTSW	12	112163542	critical splice donor site	probably null
R7595:Kif26a	UTSW	12	112179325	missense	probably benign	0.30
R7630:Kif26a	UTSW	12	112175697	missense	probably damaging	1.00
R7784:Kif26a	UTSW	12	112178147	missense	possibly damaging	0.66
R7992:Kif26a	UTSW	12	112176047	missense	probably benign
R8170:Kif26a	UTSW	12	112175318	splice site	probably null
R9206:Kif26a	UTSW	12	112178046	missense	possibly damaging	0.92
R9287:Kif26a	UTSW	12	112179285	nonsense	probably null
R9293:Kif26a	UTSW	12	112146401	missense	probably damaging	1.00
R9524:Kif26a	UTSW	12	112173852	missense	probably damaging	1.00
R9559:Kif26a	UTSW	12	112175570	missense	probably damaging	1.00
R9793:Kif26a	UTSW	12	112176453	missense	probably damaging	1.00
X0027:Kif26a	UTSW	12	112176070	missense	probably benign	0.26
Z1176:Kif26a	UTSW	12	112177618	missense	probably damaging	0.97
Z1177:Kif26a	UTSW	12	112177611	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGACTATCCACTCCAGCCTG -3'
(R):5'- CCACTAGGCCTTGGAAAGAAGG -3'

Sequencing Primer
(F):5'- CCTGTTTGAGGACCCTTGGC -3'
(R):5'- TTGGAAAGAAGGCCCCCTTG -3'

Posted On

2022-10-06