Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Ddhd1'

728933

Institutional Source

Beutler Lab

Gene Symbol

Ddhd1

Ensembl Gene

ENSMUSG00000037697

Gene Name

DDHD domain containing 1

Synonyms

9630061G18Rik, 4921528E07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45588467-45658143 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45610733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 527 (E527K)

Ref Sequence

ENSEMBL: ENSMUSP00000084577 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051310
AA Change: E493K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: E493K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	95	111	N/A	INTRINSIC
low complexity region	118	141	N/A	INTRINSIC
low complexity region	183	201	N/A	INTRINSIC
low complexity region	206	217	N/A	INTRINSIC
low complexity region	284	297	N/A	INTRINSIC
Blast:DDHD	450	573	6e-67	BLAST
DDHD	595	842	1.49e-100	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000087320
AA Change: E527K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: E527K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	95	111	N/A	INTRINSIC
low complexity region	118	141	N/A	INTRINSIC
low complexity region	183	201	N/A	INTRINSIC
low complexity region	206	217	N/A	INTRINSIC
low complexity region	284	297	N/A	INTRINSIC
Blast:DDHD	484	607	1e-66	BLAST
DDHD	629	904	3.75e-106	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111828
AA Change: E493K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: E493K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	95	111	N/A	INTRINSIC
low complexity region	118	141	N/A	INTRINSIC
low complexity region	183	201	N/A	INTRINSIC
low complexity region	206	217	N/A	INTRINSIC
low complexity region	284	297	N/A	INTRINSIC
Blast:DDHD	450	573	8e-67	BLAST
DDHD	595	870	3.75e-106	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141487

SMART Domains

Protein: ENSMUSP00000133358
Gene: ENSMUSG00000037697

Domain	Start	End	E-Value	Type
Blast:DDHD	111	149	1e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000149286

SMART Domains

Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	95	111	N/A	INTRINSIC
low complexity region	118	141	N/A	INTRINSIC
low complexity region	183	201	N/A	INTRINSIC
low complexity region	206	217	N/A	INTRINSIC
low complexity region	284	297	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Ddhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01318:Ddhd1	APN	14	45616551	missense	probably damaging	1.00
IGL01635:Ddhd1	APN	14	45629580	missense	probably null	0.98
IGL02176:Ddhd1	APN	14	45616600	missense	probably damaging	1.00
IGL02698:Ddhd1	APN	14	45605206	unclassified	probably benign
IGL03052:Ddhd1	UTSW	14	45620783	missense	probably damaging	1.00
PIT4434001:Ddhd1	UTSW	14	45610605	missense	possibly damaging	0.62
R0037:Ddhd1	UTSW	14	45610510	missense	probably damaging	1.00
R0105:Ddhd1	UTSW	14	45610690	missense	probably benign	0.37
R0165:Ddhd1	UTSW	14	45595592	missense	probably damaging	1.00
R1237:Ddhd1	UTSW	14	45601650	missense	probably benign	0.01
R1401:Ddhd1	UTSW	14	45605051	critical splice donor site	probably null
R1574:Ddhd1	UTSW	14	45595547	missense	probably damaging	1.00
R1574:Ddhd1	UTSW	14	45595547	missense	probably damaging	1.00
R1582:Ddhd1	UTSW	14	45605109	missense	probably damaging	0.98
R2070:Ddhd1	UTSW	14	45610624	missense	probably damaging	1.00
R2307:Ddhd1	UTSW	14	45608990	missense	probably damaging	1.00
R2417:Ddhd1	UTSW	14	45657272	missense	probably damaging	1.00
R3756:Ddhd1	UTSW	14	45610573	missense	probably benign	0.00
R3756:Ddhd1	UTSW	14	45657263	missense	probably damaging	1.00
R4541:Ddhd1	UTSW	14	45622856	nonsense	probably null
R4737:Ddhd1	UTSW	14	45628821	intron	probably benign
R5105:Ddhd1	UTSW	14	45657407	missense	probably benign	0.00
R5810:Ddhd1	UTSW	14	45602707	missense	probably damaging	1.00
R5898:Ddhd1	UTSW	14	45602668	missense	probably damaging	1.00
R6217:Ddhd1	UTSW	14	45619514	splice site	probably null
R6218:Ddhd1	UTSW	14	45614176	missense	probably damaging	1.00
R6671:Ddhd1	UTSW	14	45657232	frame shift	probably null
R6787:Ddhd1	UTSW	14	45657519	missense	probably benign	0.01
R7049:Ddhd1	UTSW	14	45602681	missense	probably damaging	1.00
R7150:Ddhd1	UTSW	14	45657806	missense	probably damaging	1.00
R7213:Ddhd1	UTSW	14	45657753	missense	probably benign	0.41
R7261:Ddhd1	UTSW	14	45657231	missense	probably damaging	1.00
R7522:Ddhd1	UTSW	14	45657647	missense	possibly damaging	0.47
R7920:Ddhd1	UTSW	14	45657470	missense	probably damaging	0.96
R8736:Ddhd1	UTSW	14	45599185	missense	probably benign	0.30
R8880:Ddhd1	UTSW	14	45608973	missense	probably benign
R9140:Ddhd1	UTSW	14	45657461	missense	probably benign	0.12
R9393:Ddhd1	UTSW	14	45657228	missense	probably damaging	1.00
R9398:Ddhd1	UTSW	14	45657660	missense	possibly damaging	0.60
R9399:Ddhd1	UTSW	14	45657660	missense	possibly damaging	0.60
R9502:Ddhd1	UTSW	14	45657222	missense	possibly damaging	0.75
Z1177:Ddhd1	UTSW	14	45657594	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- AAGATGCCGCTCTTCATAGCTC -3'
(R):5'- GTGGTGATACAGTTTGCAGC -3'

Sequencing Primer
(F):5'- ATAGCTCATCCACCGCTCG -3'
(R):5'- GCAGCATATATATGTATCTCCATTCC -3'

Posted On

2022-10-06